Cavia_porcellus Locus poly: SNORD62
snOPY snoRNA Orthological Gene Database
Cavia_porcellus poly: SNORD62
Cavia_porcellus
poly: SNORD62
SNORD62, SNORD62, SNORD62
1117..1202, 2413..2498, 4847..4932
6660
tctgttttgattttggtttcttttggtacttggaaagcgggggcctatttccaggagag
ttgggagctgagccccgtctgggatggctgctggctggcatggaatctggggccagtgct
gttggatggccttagaggtggccttactgacacctgctgggctgcagacctccagggcaa
ggacgggagaggagtgagggccacttcctgtagggggtccttcctcctgctcgggggctt
tggaggcacaaaagaggctctgcatgtatgcaggtgtctaggggagaggagccaggaggc
tgacagcagctctgtgtccttcttccaggactctgatttcagtttgccgcccggctctgc
ctccggacctgcagggaatcctgttgtgaaactgcaggatgccctggctagtaatgtgag
tccccttcctctgccccaccacaacccgcccactcacagcgtgtgctctctcagctcacc
cctgcctgtgtcagagtcacaactatttctaactatgcctggttgttctggtggggtgat
gttatccctacggtccgggatggtcgttttctttggtttgcagtctctgtgggccaggca
tggtcaggccccgtgcacacttctgatgggcagcaggggatggagtcaaagcaggaaaga
ccctgcatgcccatcctccgtggtccctgtagcctggctctgaacgctgtgaccccagag
gcctgtgccctgttcagggccccagcccgctgtgcactgacgtttctcaggccatgtggt
gggtgggggcaggagagacctgccgaatgcgtgaggcttgctggacagcatttctcaaag
gcttctgggaatatcagcgctgcggagtgttgaaaggcatcgagtgacagcgagtcctgg
gctcaccaggtttccctatccaggcactagtgtgacctccagcagcggtatctttttttt
atttttgtctttttcctttttatcggtaccggggatcaaactcacaactgcctgcttgca
aggcaagcgcttatgccgctgagctaaatctctagccccagcggtatcatttttgcccat
acatcaccatgcttgtcaccaagggctagtgccaaggTCTTCATGATGGAATTCCAATAG
ATCCTTCTGACCCTCCACTGTGGACTCAAAAGCAGGGAGATGACGAGGGCAGTGACTGAG
AGAccgggcggccctcaccatgtagatttctcagcgttgctgtcacattctctggccctg
cctgcggggctggcactgcccttcctacctgtgtaccagcgacctttcagttccctatgg
ggccgagttacagcaggtttttcctgctacacctgggcctctctgagccaggcagcacag
ggcacttgggtgttccctggagttggctgtgccagagtgaagggctctgcagggctgtcc
acgggcttctgtgacaaatctgatgataggaggtccaatggacttctgtcacagtcgtgg
gtgcatgcaagtgggactgcagacacaatgcgatgggtcgcctgttctgtctgttccgcc
tgggtctccacggtgtcctttcccccactctccaggcagggttaactcagagtattccca
ttctccggcgagatcatcatatccagagggccatcggcctgtctccgatgtccttcccca
ctgctgacctcacactgaaggtgactgggccctgaactggatggagaggtgggggaggag
cccggggtccccaccacgccctgtagtcatccgcagccttcccttctctgcctcggaaga
tggagtctgcgcgcaaggcttgggaaaactcccccagtttgccggagcagagctcccctg
gaggtgcgggctccagcattcagcctccgtcctcggtgggagcctccaatggagtgaact
acagctccttcggcggagtgtccatgccacccatgcctgtggcctctgtagcaccttctg
cttcgatgccaggtatgtccaagccaggcccgggcttctgtcatccagaatctaacaaat
ccgagcactgtgtccctccaagccctgacttacccacctaagtctggtgatcacggcttc
ctgggtgctgcacagctgcaccccgtcttcccatcttcaggtcacagtgaggccctccct
cccactgtcaggaagggcagtagccttgagtcagagcccgagccatttggtgccagggct
gtgccaccttggcagtgagcagctcactgggccacagcctgcttcccagaagtggcctgt
gacagtgccacatgcagtggccacaccatgaagctggacagtgctgctctctggcagtgg
tcactgcctttgcgcttgtcactatcctttgggaagtcagtgccccagggatgctgaggg
ccagctgccgaggTCTCCATGATGGAATTCCAATAGATCCTTCTGACCCTCCACTGTGGA
CTCAATAGCAGGGAGATGAGGAGGACAGTGACTGAGAGAcctggcggcctccccgtagta
aacgccctgccctaaggcgggggctttgggtgaacagtgagcgggaggccatgcccagca
gcagggaaccacgtcccctggggaaggtgggcagcgctcctgaaggggacagtcagccac
agcccagcttaactctttgctgtggtctccgggtcgtttccaggcagccacctcccacct
ttgtacctggacggccacgtgtttgcaagtcagccccggctggttcctcagaccatccct
cagcagcagagctaccagcaggtgaggggcagggccaggggcaggggcaggggcagggct
cggcccaggccaggcttctccctcaagatgcatgatagccagagggtattattgagtgaa
taaaccagggaggatgaagaaggattgagcaccacaggcctcactgcgagtcctccctcc
caccctagctgggaaatgagctgaaacagttttcgttgtgaccaggtctcctgatgtaga
gaaggagggcctgagccccaggcccaggtgtgtcagaagaggtagaaacgcaggtgttca
gctccatgcgggattgccctgcttgtgctgggaacggatgatctttgccgtcccccccca
agagctgggccaggccttcccgtcagctctcggccgagagcccccagtggagggctatcc
aacagggtctgctcccagtgcgggttcagggtctggacagagctgtggccttacctttgt
cttgaaggcctgaacttcacagtgttgtgaggctgcatcagtcacctgtaactgttgtgg
tctgtttggtgttaagtgtctgaaactggcctctgatgattcctgcagccaggattcctt
tttgctgtcatgtggaattgcacagtggcttggagttgctcccggttttcactggtggcc
tcaaccccagagcaagggagcccaggcaggactctatactggacactgggcagagaggca
gccaccacctgctgcgtggagggcttcagagcagggccacctgggagggcgtctggtcag
ctgctggcttctgtccacaggctgctgctgcccagcagatccccatctccctgcacacgc
ctctgcaggcccaggcccagctcgggctgaggggtgggctgcccgtctcccagtcccagg
agatcttcggctccctgcagcccttcaggtgagcacccacacagactgcagcgcggccgg
agctttggaccttcacgccgctttgtcccacagcttcagcgttcctctgccttgggcctg
ggcagagtgtcctctcccccactgccctcctgctgtggtgcacccagggtcctgggcttt
ggcgtcattatgtattcctgtggcacagcgtggacgtctacatggcttctctagaccagc
aacatcgggtcacccaggccccctgggggtcttgtgggggagtggggacctgtattccag
caagccctggggatcctggtgctggcaggcattggggatttgggtgggacatcctcctga
tgctgtctgtcggcttttgcaggtctcaggtgtatatgcaccccagcctgtcgccgccca
gcaccatgatcctgtctgggggtacggccttgaagcctccatattcggcgttcccgggca
tgcagcccctggagatggtgaagccccaatctggctccccctaccagcccatgagtggaa
accaggccttggtctacgaaggccagcttggccaggctgccgggctgggtgcctcccaga
tgctggactctcagctgccgcaggtcaggagttggtcacccctgccttccagcagcgggc
tgctttctgtggcctccctgaccctttactgcctcttgtgtgtgctgacctagccttggt
gacctggtgatgtgctgacctcagctctgccggggagtccattctgagaccctgttttcc
ctagctggaggccacatcctccccgatcgtactatggctgtatgggtggggagggccact
gaagtccaccccacgctgcaaatcctgtgtttgtgtggaggcctcttcctgtccactgca
ccaccggtctgtccaccctctgtctagattgtcacaaccggtccctgtgcttcttcccct
ccccacacccatgacctccagcaggtcatctgggctctgccttttgatgcagtggagtgt
cctgccatccccacgttcccccaggctcccacagtcccactgggcagtcctctcccagag
cccacaccaggccggtgttgcctggtgccagtgtgtcctggcctcctttgtgcttagcct
gccatgctccgagctggagcgagagccggagtccatggtgccctgggTCTCAGTGACCTG
ATGCCAGTGGATCCTTCTGACCCCTCAGTGTGGACTTGGCAGCAGGGCGATGAGGAGGAC
AGGGAATGGGGACgtggagtggctcaccctgctcctcctggacctaggcttgtgggcacc
tgttgctcttcaggcacagcgtgcttcgcagtgaccctctcggtccctccagggcttatt
tcctattctgtcatctgagtagcacacggctgattggactttggtgtctcgctcaggaca
ccaagatcccacatttcctgtgtgacttggatctttagaattagtctgaccattaatttt
ggggcagtgttgcatcctgtttccagactgctgtactccatcctctccttcccagccaca
cgcagcccatgagggacacacatggccctgagtagcctgtagctgtgaccagtggtgctt
gggggctcccctgtgccctgtggggtgtggctctgtgggctgcagatgcgtgcagctatg
cagaggtggggttggcagcacagtgtgcggtgctgtgggctttctccccggcatctgttc
ctcttcctgacttttgttgcccagcagctgaccatgccactgcctcggtatggctccggg
cagcagccactgatcctgccacagtccattcagctgccagcagggcagagcctctccgtc
ggggccccccgaaggattcctccacctgggtcccagccaccagtcctgaacaccagcaga
gaggtaaaagagacccaccccttgtggtctgggcgagggacccagctggggctcactgtg
tagaaagtgctggtggctttgggtatagggtctcggcctcagcagatcgaggctctccta
tgaggcagttgccagcacccagaggtcaggaatgcctccttttctgtgctagctcataat
aaaaacaagctcacgtgcagctgagaccagcgcctcacccggatggaggtccccaggccc
cagctgagtgtgcctgcccaaggctgagggccaggagccagtatttctgactggcccagc
tggttctgctgtgggtgacaactggggaaacaccgacagtgtggccagtcccctgtggcc
attcgcagctctcctgccctgctttaaaaacccaactctggtgggtggttctcgcctgta
gccccagcacttggggggttgaggtaggaccatcaccacaaggtgacggccagcttcacc
tacacagtgagagcctgtctttaaagacaacaggctgggaatttagctcagcggctcaag
cgcctgcctagcaagcacaaggttgtgagttcaatccccagtccccaaaagaaacagaaa
aaaaaaagaatgacaacaaaactcagatgcaggcagacggtccttccctctcagaagcct
ctttttcagtccgcgattaacagtctgtatactgcttctctgggggctggggatttagct
cagcagtataagcacctgccttgcaagcaggcagtcgtgagttcaatcccaggtaccaat
aaaaacaaaaaagaccaaaaaaaaaaaaaaaaaaaaaaaaatactgctgctctggtggat
acccctggacatcattggggttcatgagggccgggccatctccgatgacagtttgcttct
tggtccctttagtcctctcagatggagctgaagggcttccactttgccgacagtaaacag
aatgttcctacgggaggctccgtgccatcgccacagacctacaggtacagaccctggggc
tgggccgagtgcgcagtaggtgtgacccacagaggctccctgggccctctgctgatgagc
t
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved