Cavia_porcellus Locus EIF4A1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus EIF4A1
Cavia_porcellus
EIF4A1
GeneScaffold_5045
SNORA67
6271..6409
7804
TTAAAAAAGACAAAAAGGGGCCCTAATGTGCTCCGAGGCCACAGAAGCTAGCTAATTCA
CACCTGAGTCGGGCAATGTCAGTACCCCATCTGTGCGACCCAAGACAAATTCCCAGCTTT
GGGAGCAAGGGCAGGAAAAATGTACCGGATGTAAGCTTCAAAACTAAGGGGTTCATAGAG
AGGTTTGGGGACAGGACTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGGCCAAGGCCTTCGCCCCCTGCCTTGATAGGGCCTGCC
GAGTCACGTGGGCGGGACAAGCCCACCTCCGCACGTGTAAGGGTGCAGGGCCGCAAGATG
GCGGCCAGGCCTCGCGGCCTGACACCCGTGTGTCACTTCCGTGCCGGCGAGAAAGACGGG
CTCCCTGGCCAATGGAGGGCAGGGGCGGGCCCGCAGCCTGACAGGCGCTCGAGCTGCCCA
ATGACGGCTGCGGATTACAGCGCGTACGGCTGACGTCATGCCGACTTGCAGCGCGCCGGC
AGGCGGGGACGAGGCTGCCAGGCCAATGCGCTAGCCGGGGCGGGGTCGGCTGCTCTATAA
GTTGTCGATAGGCGGGCACTCCGCCCTAGTTCCTAAGGATCATGTCTGCGAGTCAGGATT
CCCGGTAAGAAAGGCGTCTGTAAGAGGAGGTGGCTACTTACCCCGCTGTTCCCTTCGGAG
GGCCCTTCCGGCGGGCCGGGAGGTGCCCCCGCCCCAGGCCCGTCGGGGGTGCGGGAAGGC
CCAGCGGGAGGAGCCGTCCGGGGGGCGAGGGGAAAGTCTACGGCCGACCGTGCCGCCGGG
CCAGAGGAAAGGACATCCCGGCTGGGGCGGAGCGCGCGAGGGTCTTCGTGAGGCCTCGAC
CTGGGGCGGCGCTGTGCACGAAGCCCCGGCGCTGACTGGCGAGACGAGGTCGCGACCTAG
CGTGGGAAAGAGGCGGGGGCGGCCGCGCGGCCCGGGCCGACCGCTCCGGTCGCCTGCTGT
GTTGGGGGGCGCGCGCGGCTCCGGAGGGTCCTGACGGTACCACTCGCGAGTGGCGGGGGT
GCCCGGCCCTCGGCACGTCGCGGTGGTAACGTGGGTCGGGAGAAGAAGCCGGCCGTTCAG
TGTGCTGGTTTTCTTGACGGCCAGGACTGAGCCTAACCCCGAGGAGCGGCCGCGTGAGGC
ACCAGGAGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAAATTTCCCTGCCCT
CATCCTGGGCGATGAAGGGCGGGTACTTCCCGGCAGCTCTGATGCTTCGGTAGGAGGTGC
ACGCGCTTGGGCTTTGAGCAACCAAGGCCCGGCGCACGTGGGCCTCGCAGCTAGCTCTGC
ATCCTGGACCATTTCTGCGTGGCAGCAAAGCCTTCCAACCCTAGGGTCCTCAAAAGAGGG
TTACCTCGTGTCGGGGGCGGGCTACTCACCCTGAGCCGCTCCCGAGATGGGGCAAAGGCC
TGGCTCATTCCTAAAGTGACTTGTGAGTGTCTTGGGAACTGGTGGGAATTTGAGCTGGAT
GCGGGGCAAGGCCTGATGGCATTATGCATGGCTGGTTGCCAAAGTGCTTCATTCAGGCAG
GGGGACAAAACTCATGCTTTAAATCAACAGATCCAGAGACAATGGCCCAGATGGGATGGA
GCCCGAAGGCGTCATTGAGGTGAGACTGGAACCTGACACCACCTCTTTAGAAAGGACTGT
GTCACTAGCAGTGCTTCCTTGTTCCTGAAATGCTAGTTAAGGAACTGAAGCTTGATTAGT
AATACGGCCTATTGTGGGACATCTTACATTCCTGAAGATGTCTGTGAAACATGTGGTTTT
GAGTCTTGTTCTCATCTCTAGAATTCCCAACTTCATAGGTATGTGGAGTTGAGTGGACTA
GCCTCTTAGAAGTGTTTACCCAGTGCCTACAACCGTCTGGCTTCCCTGGAGGATGGAGAG
GAGAGGCTGTGGGACGTTGCAGACACATCTCATTTGCACCAGCTCCTTTTCCACTACTTA
GGTTTTAATTTCTTTGCTTCTTGCAGAGTAATTGGAATGAGATTGTTGACAGCTTCGATG
ATATGAACCTCTCAGAGTCACTCCTTCGTGGCATCTACGCCTATGGTTTTGAGAAACCCT
CTGCCATCCAGCAGCGTGCCATTCTTCCTTGTATCAAGGGTGAGCTCTCACAGCCTTAAA
ATACAGATAGAAACTGATCTGAATAGCAGAGCATCCAGCTGGCACTTCTCATTAAAAGGT
AGAACAATTCCTTGGTCATCCCAGCTTGATTTGACTCTATCTGTGCCCGTGTCTGGTTCT
CCTCTTAGGCACATGGGTTGCTGGGGGGGGGTTTTGTTGTTGTTTTTTAAGCTTTTAGAA
TTGTTATTTCTGGGGCTGGGGATTTAGCTCAGTGACATAAGCACCTGCCTTGCAAGCAGG
CAGTCGTGAGTTCGATTCTCAGTACCGATAAAAAGGAAAAAGACCAAAAAAAAAAAAGAA
TTGTTATTTCTGGCTTAACTTGGTGTGGTATCACTGAATGAGTGGTCTGACCTTGTCTTG
TGATCTGTTCTTACTGTGTCACTGTATTGTAAAGTGATTTAAAAAGCACTTAATGCTTAG
TTTATAACTGTTGGTGCTTATTGATCTCATGAAGTTAGACCTTGAGTATCTGTGAGACCA
CAGTGTTTATCCTCTGTCACATCTAACCTTTAAATTTGTCTGTTCAGGTTATGATGTAAT
TGCTCAAGCCCAGTCTGGAACTGGGAAAACGGCCACATTTGCCATATCAATTCTACAACA
GATTGAGTTAGATCTAAAGGCTACTCAGGCTTTAGTTCTGGCTCCAACTCGAGAATTGGC
TCAGCAGGTAAGAGTGGCTTCTTTTCCTTCTTCCTGAAGGCTGCTTTAACAATGATAGGC
ATAATCCAAAAGTCAGGTGCATTCTCTGACCAGTCAAGTGAAGACACACTTAGGGTAAGA
AGTGGGTTGATGGCATGTAGCTCTCAGAATCTGCTGGGTTTAATTATAAGCTGCTTTTGA
CCTAAGCATCATAGTCACCATTTACTCCACCCATTTCCTGAGTTAAATGGGAAGGTTGCT
GGGTGGGGCCTGGCTGGCTGGGCCAGTTTGGTAGCTGTTTAGTGAAGGAACCCCCTGGCA
GTGGGCAAAGAGACACCTCACTGGTGGTGGTGTTCTTACATCAGTCAGGGGCAGAAGAGA
TGACAGTCCTTTGTTCATCCTAGCTTCATGCCTGGGTTGGTAGCTAAAGCTGTTTCATGC
CTAGGGCACATAAAATCCTAATCTTGGTCTCTGTTCTCTTATTGGGTCTTGAAGGGGAAT
GAATTAGAACTCAATAGATTAATAGCAGATAACAGATTATGGTGATGTGAACTTCAGCCA
CAATATTGTAGACATAGGGATATGTATGTGTCCTATAGAAGTACGAAGCGTTTATTAGGA
ATCTATGTGCTTGGGAAACAAATCAAAATTGTCTAGCCAGTGTTGGCAAACTATGTAGAG
CTTTCAAAAAATGATTCAGTCTGCTGTGTATGGTAGGTTCACCATCACTGCTCTAGGCGG
TGGTTGCTTTGTTTTGGGGTTTTGTTGTCTTTTTTTTTTTTTTTTACTATGTAGTTTTGA
GTTGACCTCAAGCTTATGATAATCCTGCTTCCGCCTCCTGAATGTTAGGATTCCAGGCTT
GTGTCACCATGCCTGTTAAGCCGTTCAGGCTGGCCTTGAGGTCACTTTGTAGTCCAGGCT
GGTCTCAGACTCCCAACCATCCTCCCACCTCAGCCTCCCGAGTGCTGGGACAGGTGTGAG
CCACCACCCCCAGCACCTACCATGCCTCTTTTAAGGAAAACTACTGGTTGCCTTTTGCCC
CTGATGTTCTTCCAAAGTGAGTTTTGTAGTAATGCACATTTGAAGGTTGAATACATAAAA
GACATTAAGATAAAGAATCAGGTCCCAGGTCCTAGCTGAGTGTGGTGGTGCACATCTGGG
ATCCCAGTACTTGATAGGCTGAGACAGGAGGATCAGTAAATTCCTTGCTAGCCTGGGCTA
CATACGGAGTTTAAGGCCACCCTGAGCTGTAAAAAAAAAACATTTAAAAAAACAGGAACC
TAGGTGTGGTCAGAGTTAACAGATGAATACCTTTTTTTTCTTGATTCAGATACAAAAGGT
GGTCATGGCATTAGGAGATTACATGGGTGCCTCATGTCATGCCTGTATTGGGGGTACCAA
TGTGCGCGCTGAGGTACAGAAGCTGCAGATGGAAGCTCCTCATATCATTGTGGGAACCCC
TGGCCGCGTGTTTGATATGCTTAACCGGAGATACCTATGTGAGTACTTCATAATTCCCTG
GGTCGTTTCTGTCGAGTCCTTGTTTCCCAGGCGTTCAGCTTAATTAAGCCAAGTCTCATT
TCCAAGGATGCTAGTTTTCTTTTCCCTAAAATAGTTGCTCTGTGATGAAGCCCATGCGTG
TCATCTGAGCCTGGCTTTCCTCTTATAGCCCAGGTAGTGTTCTACTTCCCAGGGCCATCA
TGTTGGGGGAAGTCATGGGCAAAGGATCAGTTTTTAAATTCTGAGAGCAGACTGCCTTTC
CCTCCTCTTTTAATCCAGAGAGTTGGGTAAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTTAGACGAAGCTGATGAAATGCTGAGCCGTGGATTCAAGGATCAG
ATTTATGATATATTCCAAAAGCTCAACAGCAACACCCAGGTAAAGAAAAGTGCCATCTTA
CAAGTAATAGCCAGTGATTCCTTAATTTGATTAAGATGTAGCCAGGTTAAATTGTAGGGC
AGTATTGTAGGACATTTTATGGATTGTCTTTTTTCCAATAGGTAGTTTTGTTGTCAGCTA
CAATGCCTTCTGATGTGCTAGAGGTGACCAAGAAGTTCATGCGGGACCCTATTCGGATTC
TCGTCAAGAAAGAAGAGTTGACCCTAGAGGGTATCCGCCAGTTCTACATCAATGTGGAGC
GAGAGGTGGGTGCAGTGTCTGAGGCCGGCCTGGTGACCAGGTGCTGGATGCTGCCCTTAC
TGATACATTTTTTTTCCTATCCAGGAATGGAAGCTGGACACGTTGTGTGACTTGTATGAG
ACCCTGACCATCACACAGGCAGTCATCTTCATCAACACCCGAAGGAAGGTCGATTGGCTC
ACTGAGAAGATGCATGCCCGAGACTTCACTGTCTCTGCCATGGTGAATTTTCTCTCTTGT
CAAAGGCTGTATCAGTGCCATGTCTCCCCAGAACCCCTGTGCCTACCCGCTCCCCATATC
CTCTCTTCCATCTTCCAGCATGGAGATATGGACCAAAAGGAACGAGACGTGATCATGAGG
GAGTTCCGGTCTGGTTCCAGCAGAGTATTGATTACCACTGACTTGCTGGTAAGTAGAAGG
GTATTCTGAAGATTGGGAAAAAGGAAGGAGAATCCAAGGTGATTCCCTCTCCAAGAGGCC
AGTCAGTGCCCCTTTCAGGAAAGTAGCAACTTGGAAGAAAATCTGGCATGCCTGAGGTCG
GGGGACAGGGGATTCTTGTTTCCTTTACCTTCCTTTGGCTGCCTACAGGTATAGAAGTGC
CCTCTGGGTATATTGTGCCTTTATTTGCAAACATTATTTATCTTTTTTACACTTAGGCCA
GAGGCATTGATGTGCAACAGGTTTCTTTAGTCATCAACTATGATCTTCCCACAAACAGGG
AAAACTACATCCACAGGTCAGTAGGCAGCGGGTACCTGCCCGCCTCCCTTTGCCTGACAC
CCCTGAGCCCGCGTCTGTTCCTCCTCCCTCTTCCTATTGCATTGTTCCTGTTTTCCAGAA
TCGGTCGTGGAGGCAGATTTGGCCGCAAGGGTGTGGCTATTAACATGGTGACAGAAGAAG
ACAAAAGGACTCTGCGAGACATCGAGACTTTCTATAACACCTCCATTGAAGAGATGCCCC
TCAACGTTGCCGACCTCATCTGAGAGGGGCTGTTCTGCTTTCTAGCCCCAACCAGAGTTC
AGCCTTTGGGGGGCTGAGGAGCAGCTGGAGGGGGGAGGGAGGGGAGCCAAGGGATGGACA
TCGTGTCAAGATTGTATTTTCATTTTGTTTCTTTTATTTCCATCGAATAGACTGTCACTT
TTTGAGACAGAAGAAGGAACCGTGAACATTTATAGACACCCTTTTTCTGTGGGGGGTACA
TGTGCTCCCGGGCGCGGTCTCCTCCCAAAAACAACTAAATTCAGTATGCATAGCATAGTT
GCCATCAAGTCCCGCGATGCTCCTCACTCCCCTTGACCCAAATCTCCTAGGGAGGTCCAG
GGGAGTGGTGTATCACGTTTAGCTCGATTCTCACTTGCTGGGACCANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGA
GGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 2370..2418, 2786..2918, 3467..3606, 4909..5077, 5449..5558, 5681..5824, 5904..6041, 6138..6227, 6476..6555, 6658..6800, 6803..6804
1001..1023, 2370..2418, 2786..2918, 3467..3606, 4909..5077, 5449..5558, 5681..5824, 5904..6041, 6138..6227, 6476..6555, 6658..6799
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved