Cavia_porcellus Locus ENSCPOG00000011651
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ENSCPOG00000011651
Cavia_porcellus
ENSCPOG00000011651
scaffold_47499
SNORA64, SNORA64
1781..1910, 2531..2664
4017
GGCCCAGATTCCATCATTTTAGCCCTGAGTACTTCGCCTATCAGCGTACAGGTTATTTT
TGAAGCATGGATAGACCTGGTTTTCAGACTAGCTGACACGTGGATGGATGTCACCTGCCA
GTCTCCCAGTCATTACCTTTCTGGTGTCAAAGGTGGTGATGACTTGATGTGGGTGAGAAC
ACCTCACTAGAGCTTGTCCAAGCCATAATGGGTCGAATGGATCTTTCACATGGACAAGTA
GTAGGAAAAACTCCAAGACCAGTCACATACGGGAAATTGAGGCAGTTTTATTTGAAGTAT
GGGGCCAATGGAGCTTTCCTGCCCACGCGGTCCTAGTGTCGTCAGCCAAGGGGCAACCTG
GAAACCTCTGGAAAGAAAGGCAAGGTTCAGGGGTCTGAGGCCGTGCGTGCAGCCTCTGGG
GATGTCGGGGCCTGGGTTTCACCCACCCACACCGGCAGTGGGCGGTGAGCTGAGGACCCT
GGACGTTCTGGGCGCCGAATCTCACCCGCGACTACGGCCAAAGCCGGGGGTGATTTTCAA
CAAACGCCGGACTCCAAGCCATCCGTATGTAAGCGCGGCGGTTCATCTGGTTGAACTTAC
CAGGAAAAGATGAAACCACGAGGCGCCAAGAAGTCGAAAGAACCAAATTGCCCGAGCGCT
CCAAATTATAGCAGCTCTTTATCTGCGCAGGCGCAAACCTAGGCAGCCAGAAGCGTACGT
AGAGCTAATCATAGCCGCCTATGGGCGCTCGGGGCGGGGCAACCGAGATCTCGCGGCGTT
TTGTGGCATATAAAAGTTCCTTGTCTAAGCGGCTCGTTCTTCTTCCTCGAGGAAACACGT
GAGTTATTTCTGTGTTATGGCCGCTCAGGACCTATGCAGTGGGGATCCCCGGACATCGGG
CCACGCTTGGGCCTGGGGGACTGGGTAAGGGCCGCTAGGGTGTCTGGGGCTGCTGTAGAG
ATCCGAGCCCCATTGATTGTTACTGTGCCTTTTTACAGCAAATGGCGGATGACGCCGGTG
CAGCGGGAGGGCCTGGAGGCCCTGGGGGCCCAGGTATGGGAGGCCGCGGCGGCTTCCGCG
GAGGCTTCGGAAGTGGCCTTCGAGGCCGCGGACGCGGGCGCGGCAGGGGCCGAGGCCGAG
GCCGCGGAGCTCGCGGCGGGAAGGCCGAGGACAAGGAGGTAGGTATGCCACTGTGCGGGT
CTGATCCTGGGGTCGAGCGCCTCAGAAGCGCCTGTTGACTGACGTCTTTATTCACAGTGG
ATTCCTGTCACCAAGCTGGGCCGGCTGGTCAAGGACATGAAGATCAAGTCCCTGGAAGAA
ATTTATCTCTTCTCCTTACCTATCAAGGTACTGCTGTGACCGGCTAGGTTCTGTCCAGAA
GCGTCATTTAGACGGGGGTTGGAGGGTTGAGATCTACTGTAATCAGCATCAGGAGGACTT
TTTGGAAAGGTGTCAGTCGTAAGAGTGTGATTCGGCTGGGATTAAGGAGATTTAACTTGG
AAAAAGTTGTCATATCTTGTGCTAGGAAGCCTGGCCTCACCACTGCGGTTCCTGGGTGAG
TGTTTTAACTTAAAAGTTTTTAGTATTTTTGCCAAAAAAAACCCTCATTTGTTGCAGGAG
TCTGAGATTATTGACTTTTTCCTGGGCACATCCCTCAAGGATGAAGTCCTGAAGATCATG
CCTGTGCAGAAGCAAACTCGTGCTGGCCAGCGGACCCGGTTCAAGGTATCAGGACCATTT
TGTGTTTTGTCAAGGCTGTTTGTACCAAAACGGGGTGGGTAACTCTCTCTACTCTGCACG
GTTACACTACTTATAGTGTGACTTTCGTACCGGGGAGAGAGAGAAAAGAGCTCTTCAGGA
CCTTGGACTGGCCTCATAATGGCCTTTCTTTCCTTGAGGGGCACAACAGGCCTTGGATGG
TGAAGGGTATCTATCCTGTGGAGAACCACAGCTACCTTACAGTCTCTTCACAGGCATTTG
TCGCCATTGGGGACTACAACGGTCACGTTGGTCTGGGTGTAAAGTGTTCTAAGGAAGTAG
CTACTGCCATTCGTGGGGCCATCATCCTGGCCAAGCTCTCTATTGTTCCTGTGCGGAGAG
GCTACTGGGGGAACAAGATTGGCAAGCCCCACACAGTCCCTTGCAAGGTAGGCTGGGTGG
TGGTGGTGAGCGATGAGTGTGCAGTGGAGACATGCTTTGATTCTTTTTTTTTTGTCCTTT
TTTTTTTATTGGTACCGGGGATTGAACTCACGACTGCCTGCTTGCAAGGCAGGCGCTTAT
GCCGCTGAGCTAAATCCCCAGCCCCATGCTTTGATTCTTAACCCTGATTCCTGTCTTTCT
CAGGTGACAGGCCGCTGTGGCTCTGTGTTAGTGCGTTTGATCCCTGCCCCCAGAGGCACT
GGCATTGTCTCAGCCCCTGTGCCCAAGAAGCTGCTGATGATGGCTGGTATTGATGACTGC
TACACCTCTGCCAGGGGCTGTACTGCTACTTTGGGCAACTTCGGTAGGTGGCCTCACGGT
GTTGACAGTGACCTCTCTCAGCTCCGCTGGATCACACAAATGCAGTGTGTGTGGTGGCGT
ATTTCAAGGGAGAGAGAGGAAGGCCCTCCTAATGCACGACAGACCTGCCCCAAGTGGCCT
CTCTGTTCCTAGGAGTGCAACATAGCTTCTGGTCTGGGGGTGGGCAGTGTGTCAAATCAG
GCCAACTATCCTCATTCTCTAATGTTACTGTTTCTCTCAGCTAAGGCCACCTTTGATGCC
ATCTCAAAGACCTACAGCTACCTGACCCCTGATCTCTGGAAAGAGACTGTGTTCACAAAG
TCTCCTTATCAGGTATTGCTGTTGACCTGACAGTGGCTTGCCTTGTCACAAGGTTGGGGA
TTTTTTTGTCATACAAGCCTAGAGGTTGTGTGTTAACATGAAATTTTTCTCTCTTAGGAG
TTCACCGACCATCTTGTGAAAACCCACACTAGAGTCTCTGTCCAGAGAACTCAAGCTCCA
GCAGTAGCTACAACATAAGGGTTTTTACACAAGAGAAATAAAAATGAATGAAGTCTGTCA
ATGGTTCTCTTTTTTTTTTTGGCTTGTCATATACTTACTGATAGCTTAATGGGGAAGGAT
TAATTGGATTGGGGCCCAGAGGGGACACCAGAAACACAGATAGGGTGTACCACTTTATTT
TCAGCAACATAACAAGGGTCAGTAAAGGGGTGCCCTCAAGGTAGGCTTCAGGCAGTACCA
GCTTCCTTGGCAGCTTTTCTTTCTGCCAGCATCCTCTGTTTCTGCTTTGCTAGGCATTTT
CTGGCAGAATAATAGGCTCCCAGGTCATTATCTAGGAGACATGGAGGGGGCAGTTGGCAA
TCAAAACTCAGAACCAGGGTGTTTGCTACATGCCGAAGAAAAGCTAGTAGGTAAAGTCAC
AGTAACCATAGTTGTGAGATTGCAAAGGCTGGTTGCAAGTCTGGGTAAGGGACTAGGGTT
GTCAGGAAGGGGGCTCACTCACAGCGGTCCTGGTAGGCCTTGGACACTTGGGCTAACTGT
TGAAGCTCCTTGGCGCAATTCTGCTGGTAGTTCTCTCCTTCTCTCTGCTGACAGGCCTTA
AGCCTCTCTTGGATGATACTGAGAATTTGTTGGTCAACTAGGCTGGAAGAAAAAGGCTGT
GCCTAAGGGATAGAATAAAAGACGGACCTCTGGGGCCCTACAGTCTGCCTCACCTCAAGA
AAGTACATTGGATGAGGCCATCCTGTGGCATTCCTAGGAAAGGCCCATTCTTAGCATTCC
TTGCTGTTTACTTACTAGTCGCGTCTCCATTGCATTTCAGCTTCAAACATGCACGGGACA
TCATTCTCCTGGCATTCTGTAATGTCTGGTACACGGCGGTACTCCCGGTGATAGTAATAG
TATCTGTTCTTGGCATGCTGCTGCTCTATAAAATCTAAAGAAGAAATCCCAGGTTCAGTT
GTGTGATCGATTTGGACGGACCACAACTAGGATGGGGACTTGTCTCTCAATGTTCTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1146..1177, 1257..1346, 1617..1724, 1973..2146, 2343..2502, 2740..2831, 2937..3017
1001..1097, 1146..1177, 1257..1346, 1617..1724, 1973..2146, 2343..2502, 2740..2831, 2937..3017
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved