Cavia_porcellus Locus CSNK1E
snOPY snoRNA Orthological Gene Database
Cavia_porcellus CSNK1E
Cavia_porcellus
CSNK1E
GeneScaffold_3852
SNORA28
4259..4386
8530
TGTCAGAGGTTTGGATACATCCTGTAGTGAAGGGAGTTTGGTCTAGGCAGGGCTCGGGA
ACATAGATATTGTGTGATCCTAGAGGAGAGGTGTTTTTTGGATCTGCAGGTCCTTACTGA
GAAAAGCGGAGATACAACATTTTCACATAAAACATACAGGTTTTTATGCACTCTTGCTTC
TGAACTTACAGGGTAGTCATTACTGTATTAGCCACATGCTAACAATTGTATCCCCAGTGT
GTGCTTTAACGGTGGTGCCACTGGAGTGTGGGAAAGAGTCCTTTCTTCTCACCTGGTGTC
CAGCAAGGGAAAGAAGCATCTCCTGGCTAGTTGAGGGTCTTCGTAGTCCTTAGCCCAGAT
GGGTGTAGAAACTTAGTCCACTTGAGAACTTCCCAGCTGTCGAGAGTTGTGTGCAGTAGG
TGCTGTGCCCGGCTGGGCTGCAGCTGGGCAGAAGGGTGATAAAAACAGCCTGGGGCTGGG
GATTTAGCTCAGCGGCATAAGCGCCTGCCTTGCAAGCAGGCAGTCATGAGTTCAATCCCC
ATTATCGATAAAAAGGAAAAAGACAAAAAAAAAAAAAAAAAAAAACAGCCCTCCTTATGG
AGGGAGCCTGGGGCATATCCCAGAGGCCTATCGAGGCAGCATGGAGGATGCCCTGAAACT
CTCATGGTATCCCTTTGGTGCATGAGTGCAAAGCCCCACTGACAGGACTAATAGGAAGGT
TCAGAACAGAAAGGACAGGCCCTGCAGCCCTGATGACAAACTGGAGTAGGGTCAGGTGAG
TGGAAGATAGGATGTCAGGTAGACTTTCCTGTACTATTCAGATAGGATGGTTTTCCCCAG
ATTGTCACCGAGGCCTCATGTCTCAGGAAGCAGAAGCGTCTATCTATTATTTGGTCCATC
TTAGAAAATTGAGGCAGTGTTCATTGTTTCTGTAGTGGCCTGTAATGTTCTGTGATCCAT
GCCAGATATTAATGTTTGTGGTCTTCATTCTTTGCTAAGGCACGGACATTGCTGCAGGAG
AAGAGGTTGCCATCAAGCTTGAATGTGTCAAGACCAAACACCCTCAGCTCCACATCGAGA
GCAAAATCTACAAAATGATGCAGGGTGGAGGTATGTCCTTTATTTGTTGAAATGGGTCAC
AAGTCACAGAATATGGTTTGTTTTAGAGGAAGAGGGAAAGATATTGGCCCATACCTATGA
CCATTTGTCACTGCCTTTATTGAGACTGGCTTAGACACAGAAATGTTTGTCTAACAAAAA
CATGATTTTTTTTTTTTTTTAGGCTTTCTGTACAATAGTACTTTACTTAACTTCCCATTA
GTTAATAGTATTTTTGAAATGTAGGCTTTGTGCAAAATTTAAAGTAAATATTAGCTATCT
ACACGATCCACAATAGCAGATCCCACCAGTGTGGTGCTGTGTGTCACTTTATGGGGACTT
TTGGTCTCTTTCAGACAGGGTCTCACTATGTGGTTTAGGCTGGCCTTGGGCTTTGTGTCC
CACGCTGGTCTTGAACTTGCAGCGATCTGCCTGCCTCAGCCTCCCAAGTGCTGGGATTAT
AGAAGTGTGCCACCACGCCCAGCTGTGGGTTTTTCAGGGTGGCATGGTGGGGTCACATGC
TTTGCTTATAGCTTTGGAGTAGTCCCTTCTGACTCCCTCTTTTAGTCCAGTTTTCTCTTG
GATAAAACAATTTATTTGAATGTGGTGATGTCTATAGCCCTTTTTAGCAAAGTCAATGTT
GCAATTCTGTGAAACCTGGCCTTGGGGCCTTGGAAACCAGTTAAGGGGTCAGAATTTTTC
TCTTAGAATTCTCTGGAATGTAAGATAGCTTGGCTGATAGAGCAGGAGGGAATTTGACTT
GAGAATTTCAGTCATGAGACGTAGCAACACAGAGGGCTGGGGGCCCAAGCATGAGTCCTT
CTTAAGGTGCAGCCTCCCTCGGCACCCATTTAGGACAAGGCTGGAGGCTGAAAGGTGGTG
TGCTCCTGCTTTGTGCAGACCCCTTGTCAGAAGTCCTTCCTGCTCTGCACAGCTGCCTTG
GCCCCTCGTGTAGTAGGAAGGCGGAGCTCTTGGTTTGACTTTGGAAGTCTTCCCTCAGTG
AAAGCTGACCTATGTACAACAACCCCCTCCCAAAGTGTCCTTGGGGCAGATGACAGCCTA
GAGAATCACAGCCAGGTCTCTGTGCTCTGATGGCTTTCAGGGGTAGGAGGGAGTGTCTGC
ATAGCTTTAAGTTTCCAACAGAATAGACTGAGATAAGGTAAGGTTCATCTTTGCTGGAGC
GACTTGAGACTTGCAGGCTTAAACGTGGTAAGGAGCACCATGTCCTTGGAAACTGTGAGC
TGGGTACCTGCAGGGTTGGGAAGAAGAACCCCTGCCAGAGCCTGAGAGACGTGTGCTGAG
ACGTGCGGCCCCGACTGCACAGCTCACTCTGGGTGGAGCAGGGCTCAGCCCTGGCCCTGC
TGCTGCTTGCTCTGTGCTGCAGGACATCTTGTAGATTCCTGTTGTTGCTCAGTTGTGACA
ACCAGGAATGTCCTCAGGTTGTGTGTGCCCTGGTAGGAAATACTGCTCTGTTTCTTGGAC
CTCTAATGTAGAATGGAAGAATTGGCTCCCTTGTTCTTTCCCATAGCCCTTCTCTGGGAT
TCTAAAATTCAGATAGGATCCCAAAAATAGGATTTCTCCTGCCTGGGCCTTTTGAGTGCC
ATTTCCCAGGCCTGGCCTGGGTTTTACTCCAATTATATAAATTGCAGAGACCATGGAGGT
CTCTATTTTAGAAAATATTTGTTCTAGCATACTTAATTCTGGCAGTGCTTGTTGAACACA
TTCAAACCACGACCAAATTGGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATCGTGCTGGGTCTT
CTGCTTTTATCCATACACACCGTACAACATCATTCACATGTTTCCCTTTGCTTTCCAGAA
CAATCTCGAAGGGACGACTTGGAGTCTCTGGGGTACGTGCTGATGTACTTCAACCTGGGC
TCTCTCCCCTGGCAGGGGCTGAAGGCTGCCACCAAGAGGCAAAAGTATGAGAGAATCAGT
GAGAAGAAAATGTCCACTCCCATTGAAGTGCTGTGCAAAGGCTATCCCTGTGAGTCCCCT
CACTGCCCGCCCAGCTGCCACCTGTGTGAGCTGGCCTCTGGATGGAGATGCTCAGCCTAG
GTTTTTGGGACAGGATGAATCATCTTCTACAAGAAGGGTAGCAGGACAGGGGTATCTGTG
TGTATGGAGGGAATGGTCTGTCCCCCGTTCTTTCTGAGAGCCCCTCTGTGGAGGTGCTCA
GTGAAGCCCAGGAGAGTAAGAGTGAGGCAGGACCAAGCCTGGGAGATGCCTGCCCAGTTA
GAAGGGAGAGGACGCTGTCTGTACTTGCCATTTGTTTGAACTGACCGCAGCCTCCAAAGC
TATAACCCAGGGAATGAATATCCCTGTGTGCTATGGGACCGATCTTGGGATAAGGACCCT
AGGGAACATAAAATTGTGCTGGGTGTGATGGCATATGTCTGTAATCTCGGCTGCTTGGGA
GGCTAAAACAGCCTGGACAACTTGGTGAAACATTGTCTCAAAATTTTAAAATACAGTGCA
AGCAACACTCTGTGACAGATTATCAAAATAATCTGTCTGTCACGATTTGAGCTTGCTAGC
AAGAAAGTCTAACGTATTCCAGCACTCTCCTTTCTGTGAGATAGGCCGTTACATAGACTG
AAACAAGTTAAAAAAAATTTTTTTTAAAAAGAGGACTGTGGCTGTAGCTGAGTGGTAGAA
TGGCCCTGAGTCAAACCCACCCCCTCCCCCAATACCAAAACAAAAAACATTTACTTCACT
TTGCCCACCCCTTACCCCCATCCCCCACCCCACCACCCTTAACTTGCAGTGCTTTTTCTG
TAGACTTGAACCATAGAGCTATTTGTGTGCGGGGCAGTTGCTTTCTCTGCCACTAATCTG
TGCGCCAGATAGTGTTTCACACCTTCCATGTGGAGATGCAGGGGTAAATGTGTGTTAAAG
ACCCTATTCTGAGTCACAGTCAGTAATTGCTCACAGCTAAGTTTCTGGTTTTACAGCCGA
ATTTGCCACGTACCTGAATTTCTGCCGTTCCTTGCGCTTTGATGACAAGCCTGACTACTC
CTACCTGCGCCAGCTCTTCAGGAATCTGTTCCATCGCCAGGGCTTCTCATACGACTATGT
GTTCGACTGGAACATGCTCAAGTTTGTAAGTGCCACTGCCAGCTCAGTCCTGTGGGACAG
GGATGGCCCAAGCCTTGGGTTTTCCAGTGTGCACTCACTGGGCTGTAAATGCTGAACACA
CAGGGTAGGACCCCAGCCTGAGTAGGCTTCTTACTTGCCTGACTCAAGGTACCAAGAAGG
AGGGTGATTTTAGGACACACAGAGAGGCTGATGGAGGTCGCAGATTTGGGCAGCAGAGGT
CCTGGAGTCTGCCATGAGCAGGTCTGTCCAGAGGCCACACCCCTGTGGCTGCTTAGTGTT
CCTTAGTTGAATGGCTGTTCTGTTGTAACAGCTGTCACTGGTTCCCAGAGCCTTGTGAGT
TGAGCCATCCGTGGCGACATGGTGTGTTGCTTGCACAGTGCACTTGGGGGAACTTAGTAG
TCACCTGAGTTCAGGGCAGGTAGCCTGGTGTCAAGCCTGCATCGGAACCTTGTAGGCGAG
TTGTGTGTTTGGTTTCTTTCATTACTATAGTTTGTCCACCAGAGATGTGTATGTCAGCGC
CCATGGGTGTGGGCAAGGAGACCTTGGAGCCTCTGGGCCAGAAAATTGAGCTTCTGTAGA
AATTCCAAGTCTTTGATTAAAGTCATTTTTGTAGGTTAGGATAAAAATTGGCACCCTCAG
CCTGGTATGGTTGGTACAGGCACATACCTGTAATCTTAGCATTGGGAGGCTGAAACAAGA
GAATCATTGCAAGTTTGAGACCAGCCTGGGCTACAAAGTGAGCTCACGGCCAGCCTGAAC
TGCATAGTGGGACCCTGTCTCAAAAAGACAAAAGAAAAAAGGCATTGGTACCCTTGGCAG
GTGAGAGCATCTTCTAACAGAGAAGCAGAACTGCCTTCTCAGAGATGCAAACCAGAAGTC
TTGCCAGGCAGTGGTGCCATACCTCTAGTTTGTGACAGGGATAGGGTAAACCAGGGACGT
CTGGCCAGGCCTAGTGCTGGAAAGAGAGTACCCTCCACCCCATAGGATCTGCACTGTCTG
CAGATTGTTCAGTGTCCGTCTTCTCCACTGTCCGTCTTCTTCGATACAATGGTTCCAGTA
TGCCCAAGATTTGTTGCAGGTAACAGTCTTGCTCTAAAAAGGACCAAGTGATTCATGTTT
GTACCAGTGTGTCAGCTTTGTACCCCCTCAGCCCAGCCATGTACGTTTGACAGAAGCTGA
GGGCCACCTGGCAGTGAATGGTGTAACTGTCCATTGAGACAGGGGTACCAAGAGGCAACC
ATAGAGCGTGGTTTGCAGACCCCCTGCCTGCAGTATTGGTGATGGAGTAAACCTCGATAC
TTGTGTGACTTTGTTAAGTGGCTGCTGAGATTGAATGTGGCACATGTCAGGTTGGTCTAG
TGTAAACCTGACGGCCAGCCTCACTGTGGCCTGTATGTCCAAGGCAGGGCTGATATACCC
ATGTCGCAACAGTAGGCACAGGCCAGTGGTCCGGATTCTAGTTGGACCCTCCATGATCCT
GCACTCCTGTCTCTAGCTGGCTCGAGCTCTCCTCCATGGCAGCATGTAGACAAAGAGAGG
CTCCGTGCTGTGGCCATGGCAGTCTGCTGGGAGTTACAAGAGGCATCCCAACCACATCTG
TGGACTGCGCCATCAATGGTCCCTGTGCAGGGCAGTGTTGTTTTCTGACTTGCTGTGCTG
TTGCAGACTACTTTACAGGGCAGTCTCATCCCAGGGTACTGGGGAAAGCCAGGAGCTTTG
GGCTGCTTCGCACCAAATCCAAATTCTGTTTCATTTTGTTCTCCTTTCCCTCCTCAGGGT
GCCAGCCGGGCTGCAGATGATGCTGAGCGGGAACGCCGGGACAGAGAGGAGCGATTGAGA
CACTCCCGGAATCCAGCCACCCGTGGCCTCCCTTCTACAGCTTCTGGCCGCCTGCGGGGG
ACCCAGGAAGTGGCCCCCCCCACGCCCCTGACCCCTACCTCACACACGGGTGAGTGCAGT
TCCTAGCATGCCTTTCATGGCGCCTGGGCAGGTCCACTTGGTGATTGATGCAGCTTGCCC
CCCCACTTCAGTCAGTTCTGATCCTGCAGGTAGATGGACCCAGGGCTCCTTGGGAAGCAC
CCTCTAGCAGGGGCCCCAGGGCTCCTTGGGAAGCACCCTCTAGCAGGGGCCATACTGTGA
AGGGCTGAGCTCTTGAAAGCTGGTGTGAGTATTGGCAGTGGCTTCTGTGGAATTTTTTAG
GCACAGTACATGTGCCCCGTGCACCTGCAAGTCCTCGCTCCTAAGTCCCCCATATCCTGG
GTACTAGGGCCGTGGGGTATGCTCCCACCACCAGCTGGTACTCCTGAACTAGCTGGTGCT
CCTATACTGGTGAACAGGTGTCGGTGCTGCCCCTGGGAAGAGGGCAGCCTTCCAGAGCCC
AGTAAAGTGGGCATTGGTTGAGACTGGCCACTGCTGTGATCTGTGTGTAGAGTGACCAGA
ACTATCAGCCATTGCAGCGCATTGGGGAGCTGCCAGGGTTCCTCGGGGTCCATGCTCTTT
CTCCTTTGCAGCGAACACCTCTCCTCGGCCCGTCTCCGGCATGGAGCGAGAGCGGAAAGT
GAGCATGCGGCTGCACCGCGGGGCCCCAGTTAATGTCTCCTCGTCTGATCTCACGGGCCG
ACAAGATACCTCTCGCATGTCCACCTCACAGGTATGCAGGTCAGGGCCATCCAGGCGCAG
AGGTAGAGAGGGTGTCACCCTGTGTGGACCAGTCTGACATCCAGGCCAGAATTGGTAGTA
GGGTGAGCCTTGTGAAGGGGCTGATGCCTTCCTTTCCTCCTCCTCTTTGGCATTTGTGAG
GATTTCTTCCCTGTGAGTGAAGTTGCGCTCCTAGTTGTGTGTTGCTTTTGGTTGGAGCTT
GAGCCAGCTAAATTGCTAAGGGCCTGCATCCCAGGTCTCTCAATGACGTAGCAGCATACT
GTAGGAACCCTTCTCTTGTACTGCTTGATTTCTGGCTACCACCCTGCAGGCTGGACTCCA
CAGGCCTGCTTGCACTCTGTAGGGGCAATGGCCTTTGGCTTCTTCCCTCGTTTTTGCTCG
CCAGGAGTGAAGGTCTGGAGAGTGGGCAGCTCCATAGGAAGGGCTCCTGTGGGCTGCAAG
CTGCTTGTCTTTCTCTGTCCCTGTCTGTCTGTGATGAAGGGGTGTTTAGGGAACCAGGCC
TACAACACTGGGATACGGGACAGAGGCTCCTTCTTTGCAGCCTTTTTTCCTCTGTGTCCT
CCCTTCTCACTCTGCTTTTATTGTTGGTGTTGTGCATTCACTAATACACTTCTCTGAACA
AACATACCAGTTTCTTTTTCTCGGATAAATTTGAGAGTTCTCTGCTTGAAGGGGTGGGGT
GAGGGTGTCAAGGACAAGTTCTCAGGTGCTGTTTCTGTGAACAGCAAACATGTCAAGGGG
TCCCTGGGTCCCGAGGAGTCTCACCAGTGAACAGAAGCTTGTGGTAGAAATGTGCTGGCA
GCAGCATCAGTCCTTTGTCATGCCATCATGTCTGTCTGGTTACTAAGAAGGAGGGGCCCA
GGTTGGCCACTGCTCAGGGTACAGGGTCTCTTGGGGCCTGCTGTGGCAAGCAGCAGGGCC
ACTGACACAGGTGATCTTTAAGTGAACAATTTTTTATTTTTTGGTACCGGGAATCGAATT
CCAGACCTTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 2945..3093, 3194..3422, 3598..3768, 4736..4884, 6657..6828, 7391..7530
1001..1109, 2945..3093, 3194..3422, 3598..3768, 4736..4884, 6657..6828, 7391..7530
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved