Cavia_porcellus Locus AOF2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus AOF2
Cavia_porcellus
AOF2
GeneScaffold_26
SNORA2
20914..21036
53794
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGCGACCCCCATGGAGA
CGGGAATATCAGAGACTCCGGACGGGCGACGGACCAGCCGGCGCAAGCGGGCCAAGGTGA
GACCCGACGCTTCTCTCCTCGGCGCGCCCAGGCCTCTCTTTCCCGAGGGTGCGCGCCCGG
GGCACGGTCTAGAGCCCCGCGACCTCCTAGTCTTCCCCCCCTGGACGCCGCGCAGCCTCG
AAGCCAGCCGGTGTAGCGTGCAGGCTAGGGCGGGAGGAGCGAGGGTCGAAGGCGGCCTTT
GTGTTGGGGCCCGCGGACGTGCCGGCGTCGGGAGGGTGTTTACCGTGAAGTCTCGTGCAC
CTTTTCGTCTTCTGGAAAAATGGCTTCCCGATATGGAGTCGCGGTTGGCGTTGTTGGAGA
TACCGCTTGTTTGCCCGTCGATGTGTGTAGAACCAGTGGCTTCCTGGCTGGTGCACAGGG
GATTTGGAGGACGATGCTAAGGCAGCTGCCTTAGCCAAGAGACGAAAAAAGAAACTTTTT
TTTTTTTTTGGTATCGGGGATCGAACTCACGACCTCACGATTGCCAGGCTGGCGCTTCCA
CTAAGCGCTTGTAGTTTTGAGCTTTTTGTTTTACTTTCTCAATGATCTTTTGCTGTGGGC
TTTTGTGGATATGGAAGCCGATGAGGAGGGCTCATTAAGGTGCACATATATAGGAAGAAA
GATTTTGTACCAAATAGTACAATTAACTGCTTTCTATCTCTTTGTGTCACCTGGTGTGTC
CCATGAGTCACCAACGTTTTACATTTGCTAGACACTAACAGGCAGGTGTTGTTAGTCCTA
ACCCTTTTAGGAATGAGAAAACCGAATCAGCGANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCAGTGGCAGAGAGGCCTCAATGAATGGAGCAGAAAGTGAAATGAAGA
CAAACAGACAACTAATGATGGAAAAAGAGCACAACAGAAATGAGGCAGAGAAGGTTGGAT
ATAATTTCAAATATAGATGGCCTAGATACACTAATTTAAGGAAAAAAAGAAAGAATTGCA
GGCAGAGTGGATCAAGAGGTAGGGTCCACCGAGATGCTCTTTATAGAAAATATAATTAAC
CTGAAGAAAGGTGTATGGACTGAAAATCAAATATGAGAAAACAGTACTCTATGTGATAGG
GAACCAGAGAAAAATAGGGGCAACTGGACCAGTATTTATGGATAGGTTGAAAAGACAGGC
TTTAATAGGTAAAGAAATACAACTAGAGATCAAGTCCAGGAGTGAGAAGGTTCAGAACCA
CTTAAGTGAATAGCAGGTTGTCCCCCCCCCCCAATATAAAACCGAGGGTGTTGGGGAGAC
CCAAAAATGCACAGTACACCCTGGGGGAGTGAAAGGGGAAGAATAGTCTTTAAGAAGACA
GCAGAAGATATTGCTACTAGTGTATCAGGAATTAAAACTCATATTACTCGCACCACTCTA
CTTAGATAGAACTTACTCCATCCCAGTTTGTATACAAGCACTAGATCTGAGGGCACAGAC
AGCTATCCCAAAAATATCAGGATATAGCACAGTAATCATCTTTAATTTCCTATTAACTTA
ATCTGGGTCCCTGTATAACTTATACTGTTATATCATGACTGATCTTAGTTAAATCTCATT
TGTTTGATTGCTGTTTGTTATTGACAGGTTTTATTCAAAACTGTTAAGGTTGATAGTATC
AAGTCTGAGAGTATAGGCAACTGTACTGAAAACGACAATTATTCACTACAATACCCATTC
TGGTATGATTACTACCTGTTTTTGTAGTTCTACACTATCTACAAAGTTGTCTTTCTATTA
ATACTGTTATGTGCTGATATATTCAATTATATTATATCTGATGATATAGCCAATTCTATT
GAAGATAACGAGACACCACAGTAACCATGGTAGAACTCCTTGTACAGCAGTTTTCTATGA
CTTCGTAGTTTTATGTGTCTATAGGAATATGTTTTGCTTTGTCCTGCTTTGTTCTGTTTT
TCCCTCTCACATAGAAAGGATAGAAATATACGTTAAGACTCATGCTTGCGTAAAACCTAT
AAACAGTTTACAAGAACTGATACTATGACACATGATGAAATGAACAAATACTTTGAAGGA
AAAAAAGGCACTATAGGACCCAGTGCTGATTCTGGAGCGTCTTGTTGTAAAATCCAGTAA
TACTATTATTCTTTGTTCAGAGTGATTTTTAGTCTGTTCTGGTTTGTTTAATCTCAGCAT
AAATGAAGAAATGGATAAATGCGTGTATGTTTTAGTGTATAGGATTGATAACCATATTAC
TAAGTTTTTATTAGATAGTTGAACAGAAGTATTTGCAGTCTCGCTGCTTAAATTCCCATT
TATATGTTCCACTTTTGTATCTTGAACAATTATTTGTAAAAGAGGACAATATGTAAACAT
CAACTAGTGATTTAATACTGTTTATTTTTTTCTTTGAAAATATGTATTATTTCTACCCAT
TTTCTGTTTTGTTTTGTCTTTCTTTAAATAAAATTTTTTTAAAAGTGCTGAGGTATAGGC
AGGTGTTTTATTGCCTGCAAGTTTGTCAAGTTTGGAGACCCTCTTTTTAAAAATTTATAT
AATTACATAACCAAAATTACATTCGGTTTATTGTAAGAGGGACATGCATTTGAGGAGCCT
TGAAACTGAAGTTTCATTGTAGAATAAATTCACCCCTGGGTAGATATATGCTAAAATTAC
AGTAAAATTTATCTTTTGTTTTTGTTTGGTTTAAGACAGGGTCTCACTATGTAGTTCACA
CAAGCCTCGAATTCACTATGTGGCCCAGGCTGGCATAGAACTCACAGTGATCTTCTTGCC
TCAGCCTCCCGAGTGTTGGGGTTACAAGACCTGTAGCTTGATTTCCACACCTTGCTCCTT
AATTTGTTGTAATAAGGAGTCTTTGCTCATCAGTCAACTTTTCTGGGTACATTTTTAAAG
AGAATGCATCTTTTCATAGTTTCAGATTAACTCTTGCTATTTGCAGTGTTTATCCCCCCT
CCCATTTAGTTTCTGGAATTATTTTGTTCTTTTTCTTTCTTTTTTTCCTGTAAAAGATTT
TAATTCACAAGACATAGTCTGGCGTCAAAATCCACACCTGAAATGACAGGGTCTAGGGAT
ATTGATGGGGTGGGAAAAACAGGGGTCTGAACATGTGTAAACAAGCCTCATGGCTTACGA
CAGGTGTCCAGGAAATGGCAGTGTTAGCCTAACCTGAGGGTGAGTTTTACCCTCTGATGC
CAAAATGTTGCCCACTGGATACTTTCTGCAGATCCAGGTGACAGGCAATTTTCTTTTTCC
CTGAAGTAGTTAGAAACACAAGGTTGGCATACAGATTTGGTATTCTAGTTAACTATATTT
TTGTCAGAGATAAAGCTTTTTTCTTGAAAGTTATTAATAGCATGATACATACACGGAAAA
GAAAAAACTTAGGTGTAGAGAGCCTCAAAGTGTGAGTTGAATTATCATTGTTATGATATA
AAAGTTATAGATCAGACTAAGTCTGAACTGACGATTGTTTTATGAGGCTTATGTATTTAT
TATAGGCTATTATAAACTGACTTGTTCCTTGTTACATGTTTATTTCCCTTAATATTTCAA
ATTAGAAAGGTATTTATACTCACTAGTAGTTCTAGGTAGACTCCCTGACTTTAGGTGTTC
ACTGTACTTAGTTTTTCCTGGTTTAATCTCTACATAGGTAGAATATCGAGAGATGGATGA
AAGCTTGGCCAACCTCTCAGAAGATGAATATTATTCAGAAGAGGAGAGGAATGCTAAAGC
AGAGAAGGAAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACACA
TGTTTCTACACAGTGGCACTGATAATCTTTCGTTGTATGTCTGTACATATGTAGGAAGAA
ATTAAAGGGTGGGATAGAAGGATGTGGCAGTACCACGCATTTGGAAAGTAGTAGAAAGTA
AATAGTGTTAGAAAATATGCAGAATGACAAATCCAAGGAATCAATACCTTTCTGTTCAGT
GACTCATAATTTAAAGGTAGAATGTTATAGAAATTGTTTTGACTAAATTATGTCTTTACA
GCATATGTATGTTGTTTCTGCCAAAACTTGGATGGTATAGGTCTGTTTTGGAACAAATGT
TTAAAAAGAAAGAAAAAATATTTACATACACATGTTCATACATGTATTCATTTGGTCTGA
GGTCTAAAGAAAACTATTCTGAGTGCCTGTGAATGTTTATTATTAAACCCTTCAACCAGA
AGAAGGGGTCAGAAAAGACTATGAAGTGCATCTCAGCTAACACTAGCTTCCTTATACCAA
TGAAGTAGTGTTAGAATCTGTAGCATCGGTTTCAGCACTCTATGCATCTTTAAAAACTTT
GAACATTTCCAGCCCTGAGCCTTGGCTCACTGAAGATTTCCAGCCCAGTGGGGTACCTTT
CTGTTTTGGAGAGACCAAACAAAAACAAAACTCTGAATTTTTTATATATTCTCTTAATGG
CATCACATTAATTAATTCTTCTTGACTTTGAATTTTTCACTATGTTCCTCTTACTGAAAA
TAATTTTTATATTTCTGTTAGCTCCAGATTCACTCACCTTATCAATGTTTTTAGCTCTAT
ATTCTTTAAAAATAAAATGGTTATTTCAGACCCCGTATGCTGTATCTTGCATTACTTTCA
TGCTTGTGGCATGTTTTGACAAGTTTTATTTTGGCTTAGCCTTTTTTGGTAGTACTCCTT
CTCTCTGAAGTTACTGTGAATTAATAGAAGTTGTCTTTTTTTTTTGCTACCGGGAATTGA
ACTCATGACCTCATGCTTGCCAGGCAGGCGCTGTGTCACGGAGCAATATCTCTGGCCCCA
GAAGTTGTCTTTAAACACACACGCACAGCCTAGGCTTCACATGCAAGTGTTAAAAAACAA
TTACTTTTCTTTTCTTTCTTCTTGTCAGGTAGGACTAACTTCAAACCCAGGGCCTCCCCA
CTGAGCGGCACCCTCCAGCCTTTTCTCTTTTCTGTTCCCTCCGTCATTACCTGCCTCGTA
GGCAGGGCTCACACTTGCCCAGGAACTGAACTTCTGCTTCAGCTTCTCACACTGCTGGGG
TTACAGTGTATGCTGGCACACTTTGCTAAATAACAAAAATTTATAATATACAGGATTGAA
ATAAAGTAATACTGTTTGAAAACAATAAGGTTAGTTTCTGGGTTCAGTTTATTCCATGAT
TGACAGGTTTTGTTTTTGTTGCTGTGCTTTAGAAGAGTAGTTCTCATAAAACTGTCCTTG
ATGGTTTTCTGGGTAACTCCTCATTGGAAGGGAACAGTCTGTGTGACACATTACTGTTGG
GCTAGTATCCCCAGGCACATGAATGGGTGTAGCATCCTCTGTACCTCAGCAGCATCTCCA
TTGTTTGTCTTTTTCCATAGAAGTCTTCTACACTTAGCTCTCTTCTCTTCTTTCAACTCT
CATCTCCAACCTTTCTTGGTCCACTGTAAATTCTAAACTATGTTTTAGCATTGGCATTTT
CTTTTTCTTGAAAGATTTTTTTTTCACAAATGTCAGGCATTGTTCCCATAAAAAGTGTCT
TAGCAAAGGGATTTGGGGTTTGGGGGCAGCTGTCATTATTGTAGTGTATTGGAATATGCA
GTGCTTTAGTTTGAATAGATTTTCTTAGTCTTTTGCTTTTATTTTTTTGAGACAGAGTCT
CACTGTGTAATCCAAACCTAAATTTACTGTGTATCTCAAGGTTGGCCTTAGTGTATTATA
GCTATGTGTCACCTTATCCTGCTATCCTGGTCTTTTTTGGGAAAGTTAAAAGTTTTAAAT
TGAAGCTATCTGCAGTGCTTAGAGATGTGTTCATGATAGCCAAAAATTGCCTGCCTCGAA
AAAAAATTAAAAAAAAAAAAGAAATCTCAATCAACACTTGATTCAGTATTGTTATAAGTT
TAACTGCTATTGTTGATATGAAAAAATTTTCCCTTTAACATAATTTAAATCATTTGAAAG
TTTCTGTGGTGAATTAAGGAAATATTTTTTTCTAGGAAGCAGTAGCAATTTAACTAGCCT
CATAGTTTAAAAATAGACTGGACCTTTATGGTGAATTATAATTATTATTAGATGAATTAA
ATATTCAGATATTGTTTAGGGTTACCACATTTGTTGTATTAGAAAAAACTCTTTCACAAA
TTTTTTCCATTAAAAACCAAATGGAAGCATTGTCATACAGGATTTTTAAAACCTTGGAAG
ATGTGTTTGTTTCCTTACCAAACTCTTTATTTTAGTCACTTATTTAATAGCTAACTGAAT
TCTTATAAAATGCATATATGAGATTTGTATACATTTTATTCTTACAAACTTTTGAATTTC
TTGAGAAAAGTTAATTTTGCTGTCCATAATTTTGTTGTTGTTGTTTTCTACTAGGGAAAT
CGAATTCAGGACCTTGGCCTCCCAGGCAGGTGTTTTGTGACTAAGCTATATCCCCAGCCA
TAGTGTTAATTTTAAGAAGAAAATATTTTGTCCCTTATGAAAGCACAAAGTATTTGGATG
TCAGTGGATCTAGTAATTTGAGTGGAGAGAATTCCTCTAAGGAGAGGACTAAGGAGAAAG
CTTGAAAAGGGAGTTTGGAGCCTTAATGTGGGTTGCCTCGGTTGATTAAGCCAGGCCTGG
GAACCTGAGCTGAGTTAGGAGACTGGGAGTTGGGGGTAGCAGTGAGAATGGTTGGGGTTT
TTGCTTTTGTTTTCTCAGTGCAGGAAGACAAGAGGGTGCCTTAGCGCTAAACTGCACCTG
CACCACTCCCACTCCTGAAATCCGGAGGCTGTTTGAGCAAGAGAAGTTGTAGTGAAATAC
ATGTTGGAGAAAGAGCAATCTGGTGTGCTCTGTAAGGGTGACTGAAGGAGCAAAGGGACT
GGGGTTGAAAAGGTAACAGGCTGTGTCGGTAGCTGAGTTTAGTAGATGGGGTCTGGGAAC
CTTTGCTCAGTATCAGGGTAGATTAGGAGGGGGTGGAGGTCCGTGCTGGGAGTTGAACCC
ATGGCCTTGCTTATGCAAAAGCATGTGTTTTTACCATTAAGCTGCATCCATAGTTTCCAA
AAGGTGATTTTCAACAATGAAAATACAAAGGTGGTTGTTGTTTTTGTCTGATTGGATTTT
TTTGTTGGGAAGAAGTTCTCTGTTTTGACTTAAACACTATTTTTAGGTTTTCAACTTTTT
AAAAATAGCACTATTATTCAGAAATTAATAAATATCCTTTGCTATAGTTGCAAATCAAAA
GGGAACTCAGAACTGAACAAATTATTTCAAAAGTGACCTAAAAAAAAATACCTCACATCT
AACCTATGATATATAATGTTTCTGTAGTCAGAAGTACATATATAACTTTCTGTAATCAGA
AAAAATATATAGCTTTAAATTTGATACTATTTTTTAAAAATAATAAAATTTGTATAATCT
ATAAATTATCTTTCATTTTAAATATTTTTATTAGTGCAAGTTTATAGTACGTAATGATCA
CAGTCCTTGTGGGGCGTTAGTATATGTGTGTTACACATCTTGATTCTTTTCTTTTTTAAA
ACCCTTTCTTCCCCCTTTCCTCCATCTCAGATTTTCTGTGTGACATTGTAGACTTGGTGA
TGGTCAAAGTGGGTAAATATATTTTGATTTGTTTGTTTTTACTAAAGATGTTGATGTCTG
AAATCTACCTAATTTCATTTTCTTAAAAATTTCCATGCATTTTAATATTTACTATCTTGT
TTAGTATGTTTTAACAAATGATAGATTTGTTTAGTTTCCTGTTTTATTTCTGTGAAGGTG
AACATAGCCTTTTGTTTGAACAGATTTTGTTAGAGTTGTGTATTTGATTATTAGTAGGAT
GATGTAATTATGAAGCTTTTATAAAACAGTAAAAATCTCATTCAGTTGGACGTTACTGAT
TTGGAATAACTGCCCTCCTGTTGAAGTATCCTTTTTTTCAGAAAAATGCTGTGTTGCTTT
TGTGGCTGTTTGTTACCTGATGTACCTTGGGTCATTTCTCACATTCACTTTAGTAAGGTT
TTAGTCTTCACTGATTTCCTAGTACTTAGCTCTTTTGATTTTCATATAAAAATGCAATTT
AGATTTTTTTCTCTACCTTTTCACAGTTGTAATTTACCAGAAAACACTTAACTGAGTAGT
TTTTGGATTTGTGTTTTCTCTAGAGAGCTCTGGCTTGGGAAAATATTTTAGAAGGAACTT
TTTTTGTGTGTAGCCTGAGACTTTTGTGGAAACATTAAAATAAGAAAAGGAAATTTGAAA
TGGGCTGTTGTGGACTGGAGATTTAGCTCAGCAGCATAAGCGCCTGCCTGGCAAGTTCGA
GGTCATGAGTTTGATTCCCCGGTACCAAAAAGAAAGAAGTGGGCTATTGTGGTGCCTTTC
TCAAGGCTTCCAACTAATGGGTTTCTCAGTAGAGGAATCAAGGGTCTGTATGTGTAACAG
CATATGCATGAGTTTACCATTTTTTCCAAGCACAGTGATGGTTCTAATACTTTATAATGA
AGCTCAGAAGCTCCCATATGATTGGTTGTCTATTTTATTGAATGACTATGGAAGGAATCA
CTTTACCTTGTTTATATTCTGGGACCAGAGGAAGTTCTCCCCGTAGAAGAGAAGGCTTTT
CTCTATTGTATATGGGACTCTTGGAAGTGTCTGTGCTTAAAAGATGCTTTTTGTTTTTTT
GTTTTTTGTTTTTTTTTGGTACTGAGGAGCTTGCCAGGCAGGCACTTGTACCGCTGAGCT
AACCCCCAGCCAAAAGATGCTCTTAATTAACAAAATTCACAGTGTGAGAGATTGATGTGA
CAAAAAATTCTGTGTAGTTAACCAACAGAAAACATAAAAATTATGGGTAAAAATAATTAA
AGATTTGATCATAAATGCTATTTTAATAATGAAAATGTTCATATGACAAAAGATTGAGGG
CCGAATATTTGGTGAGTTATTTAGTAGAGTAAAAATCCAAAAGGCAGAATCTTTTAGATA
TTTCTTTAGAGTTGGTATAATGGCCATTTCATTGAACAGTGCTTTCTTTTTGTATATGTG
AGCAGTGTTATTTCTTATGTGTTACACAGATAGTGAATGGCTAATTAGCAGACTAGCTGT
ACCCATCTTCAGACAACAAATTAGTATAATAAGTTTGACCAGAAAGAAATTAACAATTCA
TTTCCTTACTTTAAAGGAGGAAAATGAGTGGTCCTAATATTAACCTTACCTTAATATAGT
TTTTGCGTGATTTGCAAGGAACCATGATTCCCCTGAAGGCAGGCATATAACTGCAGTTGG
TAGTGGGCATGAATGGTGGTGTAATTATGATTTCAGAACTTCCAGATGATAAAAGGAAAA
CATTAGAACTCCCAACCTGCTAGATGTCTGATCCACTGAATTCATGTTCCCCAAAATCAA
AGAATGAATTCTAAGACCACCACAGGTTAAAAGTAGGTAATTTTATTGAGAGAAAGACAG
TTCCTGCCTCAGAGGGACAGGAGAGGACCTGGGAAGTGGGTGAGATTTTATAGAGCAGAA
TCACAAGACAGGTATAAAGTCACAAAGTGGGTGTAAGGTGGGACAAAACTATGGGCAGTC
GATAGGATTCTAGAGTCACTTAGGTAATACTGATCCAGTGAGGGAGCAAGTCACACAGCA
AGGTCCTTCCTGGATGGATGGACGAGGAGGTCTTGGTCCCACACCGAGATGACTGATGCC
TGTTTGGAAAGTTGATCATCATTGTTGTCCCTCAGGGGAGTATGCAGGTGTAGTCATCCC
GTCTTTGTCTTCAGGCCTGGCCGTCAGCAGTATGTCTTCACCCACCTGTGTTCTTTCTTC
TGTACTGACTCTCAGGGCCTGAACTTTTGTGCCTAAAATATTTCTACCTAACTTAGCTTT
CCGTAATGTAGGAGTTCAGTTAAGTAATTTTGTTTTTATCATTCTGTAACTTTTCAGATG
ACTTTTTTCCATGTCTATGAGTAGAGTCAGAGTGGGGGTAACTTTGAGAATTAACTCTGA
TATTATCTCCATAGGGGAGGTAAGAGGATTCTGTTACATCCCCATGCCCAGTTGGACACA
CTCTTTCACAGATATATTATAAGTGGCTAGGGATTTCATTCTTGAAAGAGCCGTCTGTTT
TGGCATTTATACTACTACTGTAAGATGAATACTCAAATCATTTGAGTTCTTGTTATATGA
AATAATGGTGTGTACATTCAGAAAATAGAATTAATTTTACCTTTGTTTTTGTTTTGTTTT
TGGAATAGCACCATTTCAGTTGTGATTTGGAATTGTGTGCTCCAAAGTAACTTACTGGAG
GACTGAGAAAAAATATGACAAGCTGAAAAGGTAACCTAGATCAACTTAGCCAAATTCTTT
TATTGTATTTTGAGATAGATATTAAACAAACCAGCATACACAAATACACACTGAACCATA
CATGGTTCCCTCCTTAGGTGAGTTTTAGCTTGGTGTGAAATAAAAAAAAAAAAGCACATG
TGTTTGTGTAATAGAAGGGGGAACTTTGTGAAGGACTAGCTGCATTTCACTTTAAAAATT
CTAGAAGATATTTGGAGGCAGAAAGGATAAAGAATTGGGCCTCGGGATTTAGCTCAGTGG
CATAAGTGCCTGCCCTGCAAGCACGTGGCCATGAGCTCGATCCCTGGTACCGGTAAAAAG
AAAAAGAAAAAGAAAGGATAAGAATAGGTAGTGTGGGGGCTGGAGATTTAGCTCAGCGGC
ATAAGCACCTGCCCTGCAAGCAGGCAGTCGTGAGTTCGATCCCAGTACCAATAAAGGGAA
AAGGACGAGAAGATAAAGTACAGATAGGTAGGTGTAGGGGAAATTTTCAAGAGTAAATAG
AGATCGCTTCAAAAAAAATCCCACCATGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTAAAGACTCTGGTATTGGATCTGGTAATATAACATAATCTTT
TATGTTAAATTATAAGAACTGTAGCTCTTTGTACATAAGACTGCCCTCTCCTTAAGAGAA
AACGTTATGGAAATCCATGTGTCAACTGTTGAGATATAAAAAGTGTTGATGCGTGCTGTA
TATGATAATCATGGAGGTTTTTTAATATTTGAAAATAGAGCTTGTGGGGATTTTGTTTTA
CTTTTGTTGCTGTTTAGATTTCTTGTGTTTTATTTGAAGACAGAACATGTTGATGATTGC
CTAGAAAGTTATATCTTCCTTTTAGTAATACAGACCTATGACCTATCTATGATAAAAGGG
AACCTGTAGTTATATTTGGGTGGATGTCAGTAGTGAGAGTTCCAAGAAAATGTCACTTAG
AACAGGAAAGAAGATTCTCTTATTATGGCACTCACCCTTTGCATTGTTGCCAGGTATGAA
ACATGACAGTGGTACTTTTAATTGGAGCTCCACAGTAAAAAAAAATACGGTTTTTGTGTA
TTTGTTTTTGTTTTGTTTTGGTACCAGAGAATTGAATTCACAACCTCATGCTTTCTAGGG
AGGCCGCTGAGCTATATTCCCACCCCTATTATGGTCCTTTTTAAAAAGAAATAACAAGAA
AAGTAAGCTTTGTTATTAGCCATTCAGATGCACCTAAAGCTTTGCAGTTGAGCAACATAA
CATAGCATCTGAATAGCTTTCTTTGCGATATTTTGAAATGTAAATTATGAAGACTTTGAA
GCAAAATAAACAAGGACCAGGAAAACCCCCAACAATGGAATGTCTAGGTAAGTAGCATAT
AAAAATATAAGTCCTTTGGGGGGGCAGTGATCGAACTCATGGCCTTGCACTTGTCAGGCA
GGCGCTTGGGCCATTGAGCTAAATCACTGGCCCTATAAGTTCTTTCTGTTAACTTGTAGA
GAGTTTACCTTCCTCAGCTTGTATGGCTTTTACTTTCGTTAGAGAGAATTCCAGCTATTA
AGCTTCTTACTTCTGCTGTGGTACAGCGGAAGTTCCAGGAGGTTCCTAATCCAAGCAGAC
CTTAAGAAGGCTGTCTGTTCAATATTTTAAATGATAGTGTAACTTTAGGGTTGCTGTTTC
AATTGAAATCCATGAATTTCATTGAGGATAATTTCATTGGGTAGTGCCACCATTGTTGGC
AGTGTTAACGGGCTTCTACTTCAAAGACGCCCCTCTGGCTTTTCTTCTTGGCTCGTTGTA
GTCTGCCTTTACAAGCTTAGGTTTTATTTTACATTTTTTCTTGCTGGTTCAGATCATTTA
TTATTCTGATTATTTATTCAAGTGTTGTGGTTTTAAAAAAATGAAAGTAGCTGGAAAGAA
ATGTATTCAAATATATTTAGGTGATGTTTTTAAAGCTACCTTTCAACTACAGAGAGGGCA
AAAAGGCACCAGAGAGTGGTTGATCATCACTGATAATTCTTTGCCTTTCTCAATTTTTAT
ATGTGATTTTCTCTCCTTTTGTTTGGACCACTTGTCTCCGTTGACCAATTCCCTTTTGAA
ATGAAGATTTTTTCTTGTGCTCATGAGATCAGTCATGTGTTTACAATCGCCTCGCTCACT
GAGCTGAGCCTCTTACTACACCCGTGCTGTTTTATAGTCTTTTTTAAACTATTTTTTCTA
GCTTTTAGTAGTTTTCTAACTATCTTTAGAACATTTCCGTTTAATTTAACAAACGTATCC
AAGTTTCTCATTTTTTCCCATTATATTACCATGTTCCTTCCTGAATTGAAAACCTGGAAT
CCTCTTAAGTCATTCATCCCTTTTACCAAGTCTGTTGTAAAGTCATGTGTCTTCCTGTGC
ATGGCCTTTCTAATTGCTGTGCTTTATCTGTTTACACACTCCTCCAAGTGGGTGTCACTT
CACTTCTGAACTGTTTCCATAGCCTTTCAATTGAATTTCTTTATCTAGGTCACTCTCTAA
TCTGTCTAGTACAGAGTGGTCAGATTAATTTAAAATACCACTTGTTCTGCTGCTTTCTTG
CCAAAGATCACAGTTTTCTCCCATTACTGCTAAGATCAGATGCAGGATTAGACATGAAGC
AAGCCCGGGTTGCCTCCCTGCTTGACCCCGCACCCCTGCTCTTCAGACCGTCTCTCCTGC
ATGAAGTGCTTGCTGCACAGTCCTCTTCACATACCGTGTCTGTGTCTGCCCTTTTCTGTT
TGTCTCTGCAGATGCTCGGGGCCATGGTGGTTTCACCGCCTCCCAGTCTGTCCAAATGTC
TCTGAACTTGTGCAGAAAAGTTTCCTTGATTCTGTAGTCTATGTTGGTATTTTATTTCCT
TGAAGAAAGAAAAAAGTTTCTTTGTGGATATTTTTCCTCTTTCACCAAATTGATTAAAAG
TTCTTTAAAAACAAACTCTACCTGTTCTGCCTTTGCCTTGGTACTTGGGTGTTTTTAGAT
GGGTTTTCAGTATATTAATGACATTATTATTATTTATTTAATTTTTTTGGTCTTTTCTGA
GGCAGGTTTTCAGTTTATACTTCAGGCTGGCCTTGAACTCACTTCATAGCCCATGCAGGC
CTTGAACTCGAAGTAGTCGTTCGCCTTAGCCTGCCGCGTGCTAGGAAAACAGGCATGCAC
CATCACAGCTTGCTGTTAGATTATTAAGTAGAGACTCAGATGATTTATATGTTCAGAGAT
GGTTTTATGCTTTGAAATGTTGTTCCCTCATGAGCTTATCATTCAGACTTTTGAATGGCT
TAGTAGTCAGTTTTATTTTTGTAAATTTTGTCATTTTGATAATTGATATTCTCTTTAAAA
AGCATTCCAGGAGATTTAGAAGTTTCTCATGTTCACAAAGTTACCAAGTATGAACGTTAT
TCCAGAAACTAGTCAGTGTGAACAGAAGTTCCCAGTCATGGCAAACCGGTGATTCTCACT
TCCATGTCTGGCAGATGGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATTTGTACTTGCCTGTGTCACGTGTCTCTGTGCC
ACTGTCAGAAGCAGAGTCCTAAGACAGAAAGATGTACAGAGCAGCAGATGGTGTATTAGA
AGTTTTATATATGTTCTAATTAAAGATGTAATCTGAATGGGAAGTTAGCACGTAAGTTGG
GGATAGAAATCTGTCTCTGTTAAGAACTGTGGACTTACTGTAAAGAAAATTTGTCAAGAG
CTACTTGCAGGTTAAAAGAAACTACCTTATTATATGACCTGTAGTGTGAAAAGAAGGCAT
ATAATAGAAATAAAGTAATTCAAACCTACTGATTAGCTTGAAAATGCTTTGTTTTTATTT
ATCTTTTTAATAGTGGGGAGATGATTTCATAACGTGTGATTGTTATCCTTGCTGAGTAAG
GAACTCATTTGAGTGAGGGGAACATTGTTACTTGTAGTGCCTAAATACTGTTCTTGAATT
CTGTTTTTTTGCTCTGAGCTTCTTTCCCTTTTTGTGTGTGTGATTGAATCCAGTACTTAA
TATGAATTCATATTTTAGACTTAAACTATATTTATAATTTAAAGTGCAAGGCCTTCATTT
AACATAAGTTTGCAGATTGGATTTAATGATTGGTTCTTCATGACTGCCATTTTCTGAGGA
CTTAATGTATGCCCTGAAATGAGCATATATTTTGAGAACTGTAAACAAAAAAAAAAATCA
CTGATGTTGTCTTGTCTGACTATACTCTTCTAGGACCTAGAGAACCCTTTAGACAAGCAT
AGAAAAATATTAAAATTAGATTCTGTCTTCAAAAAAGAATACATGCCTTGTAGTAGTACA
TTATCATTATTAAAAGTCATTTCTCATGTATAAATACCTTTATATACTTAAGAATGAAGA
TGTCATTTAAAGGGGCTGGGGATTTAGCTCAGCGGCATAAGCGCCTGCCTTGCAAGCAGG
CAGTCGTGAGTTCGATCCCTGGTACCGGTAAAAAGGAAAAAGACAAAAAAAAAAAAAAAA
AAAAAAAGATGTCATTTAAAGTCTTACAGATCTTGCAGTAGTTTTATAGGAAGAGAGGAC
TACATTAGTTTGACTTCACAACTCCCTTGTAATAACAAATGGTGGAACAATCAGTCTGCT
TTCTAGTTGTGATGCGTATTTTACAATAAGCTTTCTAAGAAGCTAGCTGAGGTTTAGGTC
ACTGCGGGAGGTGGAATTTTATATCTTCTGAAGATCACATTGTAGTTTTCCTGTAGTGTA
CAAGGTGCCTAGAAGTGTAAGAGGATCATAGCATTTCTCTTTAAGATAGCTTTTGGAAGA
CTAGAAGGTCATGTAGGTTTTCAGACTGAATTTGAAGCTTCCTTTTCTTGAACTTACTTC
TACACATTGATCCACAAGGAAGATTTCTTTGCAAGGCTTATCCTGTGGCTTGGGTTAGAG
GCGCCCCCAAAATCTTGCTTGCCTTTCTTCATCGCCCTGCCCCAAGAATGTGTCTATATG
CAATGCTTAGTATCTGACTAAGGTGAGTTAGAGTGTGTTCAGAAGTTTTACTCATGAAGC
ACTGGCTTATTCAGCTCTAATACTGTCTACTGTCTAATAATAAAAAAATCAGGGAGCTGA
ATTAGTTACATTCCCTACTCTGAAGAGAAGGGGACAGATTTTTCTTAGAATTGTCAGGGT
TTTACTTACTGTATTTTTAGATAGAAAGCTGAAGCAGTAAATCATGAGTTGATGCTAAAT
TTTTGAAACTCCTGGTCCTGAAGCCCGTATCATAACCATTCTCAGTCTAGAGTGGTTAGT
AAAAATCATACCCATCCACTCCCATCCTGAAAAATAGTAGAACAAAAGTTTAGTGATTAG
AAATACCACATACTTTGTTCTATTACCTTTCAACAAGAATCAGAAAGTAAAGTTGAAATT
TCCTAACTAGAATTGGGAAGATTATGATGTAATACCCTGGGCCTTGATTCCAGAAGAAGG
AGCACTCTGAATATGGGTTTACTAGTTGGTGGTGAATTTGTGAGTCGCCAACTATTAGGC
CTTTATGTCCAGATATTATCTTAATTTATGGAGTAAGGTCCCTGAGTTGTCCTCTTTCCT
TCCACAGGGCAAGCAGGAGGACTTCAAGACGACAGTTCTGGAGGGTATGGAGACGGCCAA
GCATCAGGTGAGGGTGGCATTAGATGCTTGCCACTTAGTAGCAAGAGCCGCCAAGTCAGG
GATTGATGCTTGCTTGAAGTGGTTTTGGCTGTAGTACCCACATTTTAGCCAGCAGTGCAG
GGAGATGTAACCCAAGGCCAGCGCAGTATGAGAGCAGGGAGCGCAGCGCAGCGGAGCAAG
GGCAAGCAAAACCTGTTGAAGTCCTTGGCCGTTCTCAGCCCTCCACTCTTCGACTTTTTG
AGCAGTTTTTGAGGAAATGGTGGGCACTTTTTTCCCCCAGGAGCCTTTGCAGTGAGAGTG
AACACGTGTAACATTTAGAATCATGGGACCTTTAAAGAGAAATGCAGCAGTATACACAGA
AGTTGCAGGCTTAAAACTGTATTAAAAAAAAAAAGAGTTGAGAACTGAGAGGTGTTCTAG
GACTAATGAAACAAATTATGTAGGCAGCTGACATCTTTTTAAATATGGTTATTGTGTGAT
ATTGGGTAAACTTTTTCAATTTGTTACATAGTTTAATCATTCTGTGACTTAAATAATTTG
TCAAATGTAAATTATTTTTAAAAAGTGTTCAAAGCGCTTTTTTCTTTGCAAATCAAACAG
TGTAGATTTCTACTTGTAGGAAAAAGTAAAGAATTTATGGAAACCACCATCTGGAAAAAT
TAGAGTTTATTCCAGGAATCCAAAGTAACATATCTGGATTTAATTCGTTGCCTCTTAAAA
AATATTTTATATGTTTCAGCACTCAAAGCTGGTTTATAACTGCATTTTGATAGAACTGGA
ATGGGTATGACTTTATTGTTGGAGCTCTCACCTTTCTACTAAATTTCCTTTAATGTTGCC
TGTCTGTTACAGTTTGCTTATAGTAGGAGGTCCTGGCAGTGTTTGTGTTTTGCTCTCTTG
AATCAGGAGATAATTGCATGTTAATCCTGCAGGTGGTAGTTGAGGGCATCTGGAATGTTA
GAACTAGACTTTTAAAATGCTATCCCTAAGAACCAGTATATGCTTATCCTGAGGAGTTAA
AATTGTCCTTTGGAGTCTGTTGTCCATAATAAAAAAACCTTCAAGAATGGTTTTCATTAA
ATTATGTCCAAGTAAATCTTCCATGGAACTTTTATGGGTCGGAGATAGCCTTGTAGAGAT
GTTTATCTCAATTGAATTTTCTGGTTGCTTTTTGTTTTGTTTTTATGATGATACTTGCTC
TTTTGCTTGTGTAAACATTGTGGTATATTGCCAAAAGTAAAAGTGGACTTTTTTTTTTTT
GGTAATGGGGATTGAACTCATGACCTCGTGATTGGCAGGCAGGTGCTTATCCGCAGAACT
AAATCCCCAGCAGAAGTGGTATAAAACTGGTGCTCTATGGTTACCGTTAATAGAACGTGA
GTTTTAAATGTTTCCAGTAGTGGTGACTGTTGTGAATCCTTTATACTTCCTCTTCAGGTC
TTTGTCATGCTCAGAAGCATGGATTTGTGGGAAAATCAAAATTAGAAACATGTTGGTGTT
TCTAATGGTGATCAACATTCTTCTCTTACTGAAACCAGAAAACTCTCATAAGTATCTTGA
AGCTGGGGATATTACCTTAACTTCTTAGAAGTCCACTGAAGTTAGCACATACATCCTAAA
TCCTAGAGCTAGAAGGGAACTTGAGGTCATCGTTAGCTTCCTGCGCAGATAGTGTTTGGC
TATTTGGTGATTAGGACTTGGAAACTTAAAGTTTTATGATTGGATTAGTGGATAAAAACA
ACCCTTATGGAGGAGGATGAGGAGTGCAAGAGGCTGGCTTCTTAGTAACACACGCGATTC
CCTACACTGCTAGAACTGTTTACGAATAGGCATTCACCCTGAACTGCGAAAATCTAAGTG
TAAGAAATCGTATGATTCTTCCTTTGCTTTTTTCTCTCTCCTCTTCCCTATTCTTCATTT
TAAAACTATTACAGGACTTGATATGGTATATTAATGTCTTTAAATGTAGATTCCTTAGGC
TTCTATTTTCACTATTCAACTAGAAATCTAGTTGTTTTTGGTTTTTGTTTTTAAACAAAT
GTAGCTCTTGGGGCTGGGGATTTAGCTCAGCAGCACAGTGTTTGCCTGGCAAGTGTGAGG
TCATGAGTTTAGTTCCTGGTACACACAAAAAAATCTAGTTCGTTCTTTATTAAATTAAAG
GCAAGTAACTCTCATGAAGGCCTTTGATTTGGTTTGAATATGTGTATGTCTACATCTGTC
TATTGCCTGTGTGTTACTGGACTCAGGAAAATGGTTATTATCATGAAATAGTGGGCCTAT
AATCTTAACCTGCTTCTAACTCCCCTTTTATCCCTCTGTAGGAGAGATCTATTCCTAAAG
ATCTTAATAAGTATTTACCTACTTTTGGCCAGGCATGGTGGCTAATGCCTATAATCTCAG
TGCTCAGCAGGCTGAGGCAGGAGGATCACTGTGAGTTTAAGGCCATCCTGAGCTACAAAG
TAATTAAGACTAGCCTGAACTGCACAGTGAGACCTTGTCTCAAAAATTTTTTTTCACCTA
CTTTTTAATATTTTCAGAAAAAAATGTGAGCAGTCAGACCTTTTGAAAGAGCTGTCTGCT
TTAGTATGATTGCACTCTCAAAGATGGTACAGGATATAAAGTGATGAGCAGGGACAGACT
GAACAGAAGGCAAAGTTGACATGTAGGCAGCCTTGAAGGTTTTTAAAATTTCAGCATCCT
TGGAACATTTTGAATTTCCAGAATAGTAGATTTCTGTTAATCACATCCAAACACAAAAGC
GCAAAATTATATCCCAGAGCCAAGTGTAAGTTACATACACTATACTATTGTTACTTTTAA
AAAATGAGGTTCTTTTCTGTAAAGAGATATTTAAGAGTTAGGTTATTCAAAGTGGTCTCT
TATTTCACTATAAGAAGTACATTTTGATTTAGCTTCAGAATAGTTTGGATTCTAAATTAA
CATTTTTTTCTTTGAAAAGGATTAGACTTTTTCTCTGGATTTTAAAAATAATCTTCATTC
TTTAAAATAATAATCTTTACCTCTCAACAAAAAAGGAGATAATTATTGATAGTTTTTAGG
GTCCATTTTTCATTTTTAAAAATTAATATTAGTGTTAAGGATAACAGGTTTTTAAAGATG
CATTGTGGCAGATGAAAAAGATTATTCCATTATTATAGCCTGAATCAAGGCCGGCAGCTT
CCTGACACTGTTGGTTTCAAGCAGGAGCCTAAGGAGATGTCTTTCTATGGTCATTTGGCC
ATTTCAGAAATGGGCAGTTCATTAGAAAGAAACAGCTTTGAAGCATCCTCTGCGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGGGCCCCCCCCCCCCCCCCCCCG
TGAGCGGCTGTGAGCGTGGCAGGCTCTGGTGGCCCAGCACAGGAGCCACCGGTGTGTATT
GGAACTTATTTGCGCCATGCTGGGACCTGGAGTGCCGGGAAACCAAGCAACTTCTCCCCC
GCTGCCTGTTTTGTTTTGTTGAACTTCAGTATACATAAAAGTATGGACAGCTATTTTGAA
GAGAACAAAAGACTCTACAACAGCCATCAGTGACTTCCCTATTGTCTGGTTTTGAAGACC
TAAAATGCCTTCTTCATTCAGTTCGGATCAGTTTTATATTATGTTGTTTTGTATGAAATC
TCTGTATGCGAAGACATGGACAACTATTTGGAAGAAAACAAGAGGCAACATGATAGACAG
TGAAGATCTCTAGCTTTGAAATTTATATCTCCTACATTGATTCCTTATGTCCTATTTTGT
TCTGTTTTGTTTTGTTTAATTTTACCCCCTTTAAAATAAGAATAAAAAAATTTTTAAAAA
AAGAAAAAGATTATTCCAAGTATATGTTAGTATCACAACTTTTGGCTTAATTGTATTTTG
TTTTAGCTCTTGATGTTTGATCTAGAAAAATACTTTGACATTGCCACTGGATTCGTATAA
ATAACATTCTAGTTACATAGTCTCCAAATTCCCCAAATTAGAAAACCATGTTAGAGCGAT
TTTTGGTAAAAACACTTGCGCTGAGGAACCAAATGTAATATGAAACTTAGCAGAGTTTTT
TTTCTACATGATTTTTACAGCAGTCCTTAAAAAAATTGTATTTTGGAGTAGAATTGGTGT
TCAGTGACTAGTTATTAAACATGTAGAAGATAAGATAGTTGAGAAAGAAAACTATCAGGG
AGAAGTGGAGTTTAGTAGAAATAATTGATTTTCGTGTTACTAGTGTACATTGAGAGTAGG
CTAGAGATACTTGGTTCAAATACTTAGGATTAATGTGTAGATAATAATGTTCCTTATAAT
GGGAAATAATTTGGGGCTTGGCTTTTGGTCTTTATTTTGATTTGGGTATCAGTTACTGAG
GACATCAAAGCTATATGTTTTTAGAAAATTTTATATTTACTAAAATAACCTGTATTTCTG
ATAGTTGGCATTTCTTGGCTTGATTTCACCCTTTACCTGTAGCAATATGGCTCTCTTTGA
TTATTTTTTTTCCCTGAGAAATAGTTGTGCTGACAGTACTTTCTGTTGTTCCTTATAGTC
TTTAGTTTAGACTTAGATTAATTATATGTAAGGACTGATTCTGTTTAGGCGTATGAGACA
TAGTACTTATCCTCATTTCTACAGTGGATGCACAGCCTTTTTCTCCTTCCAAGCACTGTT
AATGTGTGGCCCACATTAGTGTTAGGCATTTTTGCCTGGTCTCTTGTTAACCATTATTTT
TTTCTAGGTAGTGTTTGCCATTTGAATGTCTTATGAAAACAGACTCCTCTGTAGCTTAGC
TACAGTTTTCTAAGCTAAATCTTTACCTGTCTTGTTCGTTTTCCTAATCTTACTAATACC
TTTTTAACTTTACTTCCATTGTTAGTCCTTTCAGCTTATTTTATGTGCTGATTAATTGTG
AACATCTTGTACTCATTTTGTTGCTTAACATATATTGTCTTCAGTGATACTGAGTTTTGA
AACTATTTAAATTTGATTTTTGGGGGCGGGCATGGATGCTGGGGATTGAATCCAGAATCC
TAAACATGCTAAACATGTGCTCTACCATTGAGCTACACCTCACCTCTGTGTCTTACTCTG
CAGTAAAGTGGATCTTTCTTTATAAAGTAATCTTAGGAATATGAGAACAAAATATGCAAA
TGTATCTCTTAAAATGACTACAAAGATGTCCTTATCAACTGAAAATACTTAGAAACCAAT
TTAAAGGGCTTCAAAATTGAGTATGATGGTATATGCCTTTAACCTCAACACTCAGGAGAC
TGAGGCAGGAGAATCATGAATTAAGGCTGTCCTGAACTACATAGCAAGTCACTGTCTCAA
AAAGCAAATTTCAGAATAACACTTTCTTTGTGGTATACTTGTATACTGAATAGATCTAGT
AGTAACATGTCTGTGGTCAAGCATTTCTAAGGTTTCTACCAGAAAAAGTAAGTTTCTTGC
ATTCTTCTGACTTACTGTTATAAGTCTGGCTTAATTTCTCCCACTGCTTGCTAGCATTGA
ATTAGTGAGAAGTAGAAGATACTGCTACTGACAAGGCATACATTTCTACTATTGATTATT
TAGCCTTTAGAGCCATTTTTTTGTTCTGTGCTGTAACTCTGAAAGACGGCATGGGGCTGC
ATTTTCTGCGCCCTCACATGTTGCTTTCCCGCTCTAACGTACATTAGCATACTTCTCTCT
AATCTGGTTTACTTTTTGGGGGGTTAGGGGGAGAGCCCATCCCTAGCCCTTTTAACCGTG
TATTTTGAGACAGGATTTTGGTGAGTTACTAAATTGCTCATACTGCAGCCCGGTAGAGAT
GCGCGTCTTAATCCCATCATTCAGAAAGTTAAGCATTGTCATGAATTCGAAGCCAGTCTG
AGCTACATACATTCTGAGACCCTTTCTCAGAAAAAAAATTTCCTCAGGCGGGGCTGGGAT
TTGCATCCTCCTGACTCAACCTCCCAATAGCTGGGATTATTACAGGCATGCACCACCATG
CCTGGCTAATCTAGTTTACTTTAACAATTTGTTGTATGCTGTGATGCTGGGCATGGTGGC
ACCTGTATGTAATCCCAGCACTCTAGAGGTTCACAAGAAGGATTGCCACAAATTTGAGGT
TAGCCTGGGCTATATGGTAAGTTTAAGGCTAGCCTAAATTATACAGTGAGACCCTGTCTC
AGAGAAAAGAAAATGGTATGCTGTGAATGATGTTAAATTTAATTAGACCATCATATATGA
AGTTACTTTACAGCTGAAGAAAATAAAAATGCCTTCTTTTTTTTTGCCTTTTTCCTTTTT
ATTGGTACCAGGGATCGAATTTACGACTGCCTGCTTGCAAGGCAGGCACTTAATGCCGCT
GAGCTAAATCCCCAGCCCCAAAAATGCCTTCTTATGCCTTAAAAAGTATATTGCTTCATG
TATTAATAAACTGTAAACTTTAAACTTTTTGTTTTGTTTTTGAGACAGGGTTTTGCTTTG
TAGTTTGTTGTTTTGTTCTGTTTTTTTTTTTTTTTTACGTTGGAAGTGAGATTAGTCTGT
CAACAAGGCAGAGCTTTACAGAGTTCTTAAAGCAAAAAAGAAGCTTTGAGATTTTATTAT
TCCTAATTTTACGTTCATTTGCACTTTTCCTAGCCATGCTTTGCTCTCTTTGCTAGGCGT
GGAGGGTGCAGCTTTCCAGAGCAGACTTCCTCATGACCGGATGACCTCTCAGGAAGCAGC
CTGCTTCCCAGACATCATCAGCGGGCCTCAGCAGACCCAGAAGGTTTTTCTGTTTATCAG
AAACCGCACAGTAAGTGTCCGTGCTGGCCATTTTCCCCTGCATTATGGAAAACGCATATG
ACTTTTATAGACAAAATGGAAAAGAATAAGAAGGAATTTTCAAGTTTCCTATAATATTGT
TACTCCAGAGCCATTGTTTCCTTTGGGTACTTGTATGAACTATATATGAAGTTTTTGTTT
TTACAAATTGAGATCCTATTTAGATGTATTTTGGGGATCCTTTTCATTTGTAATCTCATC
AATGCCCATTTTTAAGAATCTTTATTTAAGAACATGTATAGAGATAGGGGATTTAGCTCC
GTGGGATAAGTGCCTGCTTGGCAAACGCGAAGCTGTGAGTTCGATCCCTGGTACAAAAAA
AAAGAACTATGCATAGGCTGTTTGCTGAAAATTACAAAACACTAGTAAAAGAACTGGGAA
CTTGAAAATTCTTTTAGTTTTACTTTTTATGGTGCTGGGGTTGAACCCAGGACCTTGTGC
ATGCTAGGCAAGTGCTATACCACCGAGCTGTTTCCCCAATCTAGGCCCCCCACCCCAAAA
TATATTTTTAAGCAGTGACCTTTCTCCCCAAGGATTAGATAAAGCGTTACCCTGTTGATC
TCATCTAATTCAACTTTCTCCTTGGCTGTATAATTAAATGTCTGCACAGTACTTTGCCTG
ACAGTAGGGTCATAATTTAACTGCCAGACATTTAAATCCCTGTTTTTGCCTTATTAAATA
AAGCTTTAACAACCTTATACAAGTTCTTACTTTACTGATGCTGCTGCTACTTATGATGAA
GATCTAGAGAGGATATGAATGCTTTTTAGGTTTTGATACCTGTTGCCAGGTTGCCTCCCA
GAAAGACTCAGTCAACACTTGTGTCATGGTGCTGCTCCTAATTTTGCTAATAAAACAATA
ATTTGTGTTGCTATCATAGGGCAATATCTCATTGTTTTTCTGTTTCTTAAATTACTGCGA
TTAACTATGTATTGGTATAGTATATCCACTTTTCATCTGAGTAGATTTCTTAGACAAATT
GTGAACCTTTTTTCTTTTTATTAAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAA
TTATTAAAAATGTTTACCTTTCATGGTATTTTGACTTTGGAAAAGAACCCAGAAGTTGCG
TGGCACCAGATCTAATGAATAAGCAGGATGAGGAGGCGCTGTGTTGTTTCTCTAAGCCAG
GTTCTCTGTTGGATGGTAATCGGTAGCAGCAGTCTGTATTTTTATCACACTTTGACATGA
CACTCACAAAAGAGGACACTCAGAAAATGACAAGAATGATGGGAGAAGTGTGTTTGAAGT
GGAAAGGGAAAGGCTTTAGGATTTAGGACCGTATTTCTTTTACTGCAATAAATGTTTAAA
AATTTAAACATTCATCATGTTTTTTAACCACACTAAATGTGAGGAATTCTTTTTCACTTG
ACAGTAGCCTCAGAGATATGGGATGTACGTGTTGATCTGATCATATCCCTTGGGAACTTG
GGTTTAGTATTATGTAAACAAATTAACTCCTTTGTTGAAACCTTGTCAATGGAACAGTCT
ATTAATTTTTATTTAATTAATTTTTAGGTAAGAAATATGGTAGTTGTCTAGGTATGTGTC
TGTGTATAAAACAGGAATATATGTATCCACTTTAAAAAGACTTCCTATTAAAATGTATTG
ACCATGCCATAGTATTTTTGATTTCTCATCTCGCTGCTTTTTTGGGCAGTTTTTAAAATA
ATTGACTGCATTTATGTTATTACGTAGGCCCAGGGTCTTTGCATTGAAATATATCCCAAA
CAACTTTTTTCTCTTTTTATTTTGAGGCAGAGTTGCTGAATCACTTAAGTTACCCAACCT
GGGCTCAAACTTTGAATCCTGTCTCGGCTTTCCAGAGTGCTGGGATTACAAGTATGCAGC
ACCACCGCAGTTCTGACTGCTCCTTTCCCTTGTTCTCTTCTTTGATTGCCCTAGATGTAT
ATCCTTAACAATTGGCCATTATGTGAACTGAGGGAGGAGCTCTCGTGCACATTTGGCCTT
CGCTATCACTCACGAGCAGGTGACTCCAGGTTCCCTTCCTACGCTGCCTACTTAACATCT
CCTTTTGGTTGCCTTAGAAGCAGACTTGTTACCTCATTTCTTCTTGCAGTAATCTCATTC
AGTCGTGGCATACCGGCTCATTCAGTTGAACAACCAAAAAAGTTGAGACGTGCCCTTGAT
ACTTTTCTCTCTCACCTCTGTATATCTATCTAATCAATAGTTAGGGGGTATGGATTTTAT
TATCTCTGGAGCTATGTGACTCAGTCATGTAACTATATAATCTTGGCATATTAGTAGGTA
TTTTTCCTTCTTAGGCTAAATATTTCTAGCTTCTTCACTCACCTGATACAGTTTTGTGTT
TTATCAGTTTTTTTTGTCAGGAATGTAACCCTCGCTGAGTAAAACTTGTATTTGAAATCT
GAACATTGAAAAGATGATTTTTACAGATGGTTAAGTGATATGTCTATTTGTTTGTAATAC
AATTTATGTTATTTAAATATAGTTACAGTTATGGTTGGATAATCCAAAGATTCAGCTGAC
GTTTGAAGCTACTCTCCAACAGTTAGAAGCGCCTTATAACAGTAAGTAGTCTGCTTGATA
GGACTAATTTTGGGCCAGATTGCAAAAATTGGTAATTTTTTCCAAGAAGCTCATGATTTT
AATTAACTTTTTCATTCATTATATACATATAATTTTACCCTGTGCAGCACCTATTTTTTC
TATGTTTTTATTTTCTGGTTTTTAAATTGTATTGACAGATGAGTTCAAGAGATTTTCAAA
TAATTTTCCTAGACTTGGTGTTCAGCTTTGACTTGTGTTTTACTTTGGCACTTGATGGGG
TAGCTATCTGGCTTTATTTCCTACTTGGCTACCGACAAAGTCTTACAAAGTTTTAACCAG
CGTGAGTGAACATTGTACCTGTAAAGTTTGTCCTCCATATCTTCTGTACTCGAATGCCTT
TCTTAAAATTTTCAAATGTGATACACATTTTGGACTACCTCAGAGTAACAAGAATCACTT
TCCTAAAGGAATCCTATGACCTGAAGCTTATAGGAAGGTATATTGAGTGACTTTATGATG
AAGAAATACAAATTTTCTGTTTAAACTTTTTAAATTTGTTTACTTCATAGGTGACACTGT
GCTTGTCCATCGAGTCCACAGTTACTTAGAGCGTCATGGTCTTATCAACTTTGGCATCTA
TAAGAGGATAAAACCCTTACCAAGTAAGGACCTGCCTGACCAACTAATGTAATAATTTTA
GATTATTGCTCCGGGACTGTTTTATATCCATGATGGTGTTAGCATTTATTTAGTCTGAAT
ATTCTCAGGTTTACCCTATAAGTCAAAATTCAGAATAAAATCTCAGGAATCAAACTCGAT
CCTTACGCTTGCCAGGCAGGCACTTACACTGCTGACCTAAATCCTCGGCCTTAAAATCTT
TAAATAAATATACTTTTTCTTTAGTTTCTACTTTGATAAACACTCAGAAAAAGATGAGAT
TTCCAAGTTTTAGAAAATTAAGAGTTTGAAGACGTCATTAAGGCTGGGGATACACCTCTT
TGGCATAGCACCTCCCTGGCAAAGGCAAGGTCCTGAGTTTGATTCTGAGTAGCAAAAATA
AAAAATTAAAACATCATTAAAAATAGGCATTCATGCCAGTAGAAAGTTGACGGTTTTCCT
CTCATTGATGCTTTCTTTTTCTTTTTCCTTTCCTTTTTTAAGTACTATCTGCCCCTTTCA
TAATGTTTGGGTAATATCTGCCGGGGAATAAGGAGTTAGGGGAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTCCTTAGTTTTGAGCAGGGTCTGGCTAGCTTTGTTTCCCTAAGGCTGGCCTG
GAACGTGTGATTCTCCTGTTTCAGCCTTGTGAGTAGCATACACTACTGTGCTGGGCCACA
CAGTACAGTTGCTTGCACTCCACTTTTTAAATCGTGAAAGACTAAATGCCTGTTGTGCAG
AGATATTGTGGTTAAAGCAGAATTGATGATTTTGGTCATTTAATTTCTAATAGGATCGGG
TGGGTGGACGAGTTGCTACATTTCGCAAAGGGAACTATGTAGCCGATCTTGGAGCCATGG
TAGTAACAGGTCTTGGTAAGTAATTCTTAGTTTTAGCATACATAGTCTGGAACTCATAAA
ATTGTTTAAGCTTACATTTCAAGACATAGGCGCAGTTTTAAAATGTACTGGTTTCAGGTA
CTGTGGTTTTGGGACTTCCGTTTGTTTGGTTTTTGTTTTTCCCATTAACACCATACCACA
GACTGGGTGAGTTTGTAAAGAAAAGTTTATTTTAGCTCATGGTTCTAGTCTAAGATCAAA
GGAATCTTGCTGATCGAGTCCTGAGGTGGCACACATCATCACATGGCAGGAGACAGGGAG
TACACATGTATGTCTGTACTCGGGTCCTTCTCCCTCTTACAAAACTACAGATGTGATCCC
GAGACACCTCTCTAATGACCTTATCTAATAACTTCCAAAAGGCTCCACCTCTACACATCA
TGATGGGATTGTTTCTGCTCCTTCATACCACTAGTGGAGATAAAACTCCAGCATGAGTTT
TAAGAAGAAAAACCATATTCAGACCATGGCCGGTACTTTCCTTTCTGTTAGTGAGAAGGG
GATTGCCAAGTAGTCTTCCTAAAGGGGTACGTTAGTATGTGCAAAGTACATGTCATACAA
AATCGTATGACTTGGAGTTGTCTTTTTCCAGTTCTAAGAAATCATTCTAGATAAACAGGC
AAGTGGACCTTGTGGTGTTGGGAGCCTTTTTTTTATGGGTATTATTGATAATGGCCAAAT
ATTCAGAACCACAAATTAGAAGACTAAATTGTTTCACAGTAAGAACCATATAACCACTAA
AAATTATATAGCACCTAGTAACTTTTAAATGTCCACAGCAGCCAATGACCGTACCACCCT
GAACACAGCCAGTTTCATCTAAATGTCCTACAGTATGTTGCTAAGTTGAACAAAGATCAC
AAAACAACACGTGTTATTCTTTTTGTGCACAGTGTGTAATTTAATGAACCTAAAAATCAT
AAAGTGTACTCACAGACTTTTTGTTACTTCTGTATGCTTATCTACATTTTACTTTAAGCN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATGTCTGTCTAGGCATTTATACAATGGACATTTG
ATGAAGGTCTAGCTAGATAGGTTTTATTTGTATTTGGCTGTAGCTACTTTCCAAGACACC
CATGGAATCAAAACCTGAGTCTTCATTTCTTTGTATTGTGTCTCCCATCATGTGCTTTTT
AGCGGTGTGCTCTTTTCTTCAATTTTGTTTTTATAAGATCAAGCTTTTAATGGGCTAATA
GACCAATGGAGGGGTACTTATGCATATGCATAGATTGGTTCAAGTATTTGTAAACTATAG
GTAGAGGAACTTTGTATCCTCAAAATGCCAGTAGCATGAAAGTGATCACTGGTCTGTGGG
AATGAGAGTAGTTTAGCCTTTGTAAGAGGGACTTCAGTGGTGAAAGTAGTGAAGGTTTTG
GGGGTAAGTGAACTTCAAGTTAGTGTTCAACAGGAAGCTTCCTGGTTCGAGGCCACACCT
CTCAGGACGTGAGCACATTATTATCTTTATGTTTTGAGGAGGGAAAACTTCACTGTGTAT
GTGGCAGCTTAGCTGCCTTTTCTGAAAGTGGTAAATCCCAACTTGAAATTTTATGCCAAA
TGCCCTAAGGGAGACGCTCACATATTCCTGGCCTGTTCTAGGTTAATGGGGTTTATGTTG
GGAGAGGACAGACTGAGGGTGTGCCTTTGTTCCCCTTCCACCATCCTGCTGTACATTTCC
TGTAAGCACTTTTGGGAAAGTTGTGGTAGAGTGAAGAACAGAATGAGAAAGGATGAGTTA
GTTCTAATTCAACAATTAAGTAAATACAGTGATTTACTTACCTGTGCATATAGAGATAAG
TATTACTATGCCTGCTGCAGTCTAGTAATACTCATATACAATGTTTTTAAAAAAATCTAG
GGCTTTCAGACTAAGCTATGCCTTCACACCTCCTTTGTGGCTTTTTTTTTTTTTTTTTTT
GGTAGTTCAGATTAGCCCTGGACACTATATATATAGTCCAGGCTGGCCTTGAACTCATAG
CTATCTTCCTGCCTCAGCTTCCCAGAATGCTGAGATTATAGGCAATATGCCACCACACCC
AACCCACAAATATTTCTGTTCCCCAGTTTTTTATTGTGGAAATTTAAAAATAAGCATGAA
AGAGAAAACTATAATGAACTCTCTTGCTTTACCTAACCCTGTTCCTGTTGGATATTTTGT
TTTTGTCTTTTGGTTTTTTTGGGTTTTTGGATAGTGGTAATTGAACTCGGGACCTTGTGC
TTGCCATGTAGGTGCTGTGCCACTGAGCTATACCCTGGCTGTTAAAGAAACAAATATATC
AGGGGCACAAAAGTTGAGGAAATTTGCCAAGAATTAGATAAAAGAACACATTGCTACAGA
AGAACCAAGGGAGTAGGAGAGTGTGTGGAGGTTGGAGGAGTGAGGGAGACCCTTTGCGAG
GAGCAGTCAGTGCAGCAGCCCATGCATACGGCAGGAAATGACTTGGAAGCAGAGGACAGT
GCAGAGTTTGCGGAAGGGGGTGAGCTCATCCTAGGAAGGAGAGGGGGTCTTTGTAGCTCT
GTCCTGTGATAATTTTGCTGCACTGGCTGGATCTTGGATGGAAGGCGGGGCGGGGAGAGT
GTGTGCAAGTTGCCTGTGTGACTGCGTCCGCCGTGGCCTCCTCAGAGCGCCTTCTAGCAG
CTCCTCTAGGGTCCCGCAGAGTCTGCTTCACATACAAGTTTACTCAGCCAATAATTTTTT
ATTTTTTAGTAAACTATTGGATAAAATGGGCTTGTTTCTCCATTCTTGTACATCAAAGGA
TCAAAAAGAGGGTAATTTTATGTTTCTGTTATTAGTATATAGAAATTAATTCTGTCATGC
TGTATAAAGCCAGCACTTGATTCAGTTATAAGAATCAGTGGTAATACTGTCTTAAAGACA
TCTCCGGACCCAGCCATTTTGCTACCGTAAGGGGAAAAATTATTCTTAGGAAATACTTTT
GGGTTTATTAGATTGTTAAGTTTTAATTACAATCATAAGAATTCCTGAGTTTATCCGAAC
TCTTTCTGTGGTCCTATATGGAGAGCTAGAATGTTGAGATTGGTTATTTCTGACAGGGAA
AGTTTATTTTATAGTTATGGATGACTAGAACAAGGACTGTCCTATAAAGGAATAAAATAC
CTTAGGAATATTAAGGATATCTCTGTCGAAATCTCCCATATCGTACCATACCAAGCCCGT
AAAAGCAGAACTAAAATGATAACCGCCCACAAATTGGTAAGAGATGAATTTATACTTTGA
CCTGTGCTATAATCATCTCTGACTAGACAGGGGCAAGGTTAGAGAACAGGTAGTTCATAA
CAGGAACATCTGGGGAGTCACAGTGAGGTAGCTGAAATATGCATAGATGGGAAAAAAAGA
AGAAATGGCTTTTTAAAGTGTTTCTCTATCTTCTGTACACCAGCTAGTAACTTGGGGTTT
TAGCCACCATCACACCCCACCTCCCCCTCCACCTCCAGTACCAGGCCTGTGCAGTGAGTT
GTGTACACACACACACACACCAAGACAGGGTCTCACTGAATTATCAGGCTGAGTGCCCTC
AGCCCTGGGATAGTAGGCATGCAACCCCAGGCCTACCTTCTTTTTTTTTTTTAAGTAATT
AAAAAGTATCTTAAATCAAATTCTTGGGGTGCTGTAGCATTCCACATTGCCAATGTTTCT
GGCTGGTTTTGGATTGTGTCCTCCCAAGTGAGATCAGAAGCCTCAGTGGCTACTTGGAGA
AACTAAGATCTTGATTTTTCTTTTGGGGACTGGCTTAGTTATTACAAAGAAAAAGGAAGA
AACAGAATGCATGAGAGGTGGTGGGTACCAGGTCACTTGAAAGCCCATTTAATTGTTTGT
CTACTCAGCGCCTTTAATATCGAGCAGATTTTCATTTGTATTCATACAGGTTTTTTTTTT
TTTTTTTTTTTTTTTGATACAGGCCTGTTACTTTTTTGGTTTTCACATTTCTATGAAGAA
ATATCCTTAGTATCTTTACAACAGTCTTTACCTTCCTGTTTAAATCTCTGTAATTTATAA
ATACAAAATCTTCTGTTTTTCTCTTAATAGTCTCAAAATTCCAAAATAAGCTGGGAGTGG
TGGTGTATGTCTATAATCCCAGAACTCAGGAGGCAGAAGCAGGAGGATCACTGTGAGTTT
GAGGCCAGCCTGGGGTCCGTAACTAAACAAAGTTCCAAAACAGTTTAGTTTTCACCTCTC
AAATACAGATACATACTAATTTGCTTTTCCAAACTATATTTATTCATGTAACAGGAATTT
ACTGAGCGCCTCGCCTGTATGCTACAGTGAACTACTTGGCCCTGCTGTGTGTGCCTCTTC
ACACACCCAGTTATTGCCTTAAATAGGTCAGAAACATTTGTCCCCTGAAAGATTCCTGTA
AGTTAAATGAAGTCAAGATACAGAGTCGCACTAAACTTTATTTGGACCAAAGGCTCATTG
TCCTTATTCTGCCCTTAGGAAGAATAGCAGTATCTTATTTCCTTGGCTGTATGAGGAATC
TGAATTAGTGATTGTTAAACATAAATTTCTTCTTCCAGGTTTTTCCAAAGGAACTAATCT
TAATCTTCTGTATCACTGTAATTCTGGAAGTGCTGAGTGATATGAGAATGACGGGGTGGA
GACTGACCATGGCCTCCATTAGCCAGATTCAGCTATTACCACTGTTTTCAGTGTAACACT
TCTAAGAATTGCCCTGGCTAAAAATCTCAGCACCTTCTTTACCGGGCACAGTGCAGCGCT
TCAGTCCATTCTCGTCTGGTGATGAGCTTACAAAGACTAGGAGTGAGATAGATGTACATG
TTCTTAAAGACCTGAAGGTTTTGGTGATGGAAGGTAGCCAGGGGTGGAACTAAAGAGATC
TGTCCTTCCCTTGAGATTGCTTCTTGCAAAAATTAGGAACCTTGTTCAGAAAAGTTATTT
GGCCTTCCCTAAATTATTCCTCATGGGTTGGACACACAGGTGGCCCTTTCCTGACATGAA
TGGTTGTGCTTCGTGTAATCTTGAGGACCAAGGCAGGAGTGAACCCATTTAAGACAATGC
AACTAATCAGGTTCTCTTAGATTGCCAGAGATACTATTTTTACCTAGGACTTTCCTAGGG
AAATAAATACCTTTGAAAGATCATAATAATACCTTTTGTTTATTTGATAGAATATTCTAT
ATTATTATTCCTTTCGCCTTCTTAGGTATTGTAAGTTGGATTATAGAAATCCACCTGCCT
TCTAACTGGTGCCTAACCCTTGGTAACCTTTTGTTGAGTTCTTTTCCCAGGATTAAGGAC
CTAGAATAAAATGGTCAGATAAAATTACTGTGACTTACATTTAGAGATTGCCAGTAGTTC
AACTTACGTTATTTTTTCACAATTATTTATAAAATAATAGAACCCAGAGATTTCTCACCC
AAGGAAAAGAAAGAACAGAGTTGCGGGTGCTTATGATAGTCATTTGCTAATTCTTTTCAT
TGTCTGAGTACATCTAATAGGACATTTTAAAAAACTAGCTTATATTTAAAAATGAAGGGG
CCAGGGGTATAGCACAGCAGCATAAACGGCTGCCTGGCACACGCAAGGTTGTGAGTTCAA
TTCCCAGTACCTAGTAAATGAATACATATGTACATACATACGTGTGTGCGCGTGCGCGTG
CATGTTCAAAATTTAAATGTATTAAAACATAGTTTTTTCCCAGTGAGTGTTAGTTTCTTA
ATAGTCAAGGATTTTGTTACTATTTTTCAAATTAAAATTTTAAAATTGATGGAAGAGCAG
CCAGGCTTTAGAGCTGCCCCTGGCTACCCTTGGAGCATCCCTGTAATTGCTTAACTTGGC
AAAAAATGGATGGGCCTGGATGCTACTTCACATCATCCCCTAAAGCTGAGCTTCAGATTG
AGAGTTGCACTGAGACATAGCCCTATCATCTGGTGTTAGTCACATGGCAGTAATCTTTTT
GTTTGATTTTTGTTGTTACTGTTCAATGTTTTTTTTTCATTCATTGAATTTTGTTTTGTT
CTCACTGCTTCCTGACACCTTACCTCTCCCTGCCTTTTTAAAACTGCCTTTCTTTTGCCA
TTTCTGTGCCTTGACTTTCCCATTTTGGTCTCTGTACAATCTGTTCCTTATTTCTCTGGT
GGTTGCAGCTTCTGAGCTAACAGAATGCTTCTGTCATGCTATGTGTGTAAAGCCTTGATT
TATTGCTGTCATACAAAACTAAACTTGATGTGGCTGTTGGGCTGTTATTTACAGTTTATT
TCTCTCTCTGCTGCACTGGTTAAAAGGACACTGTCAAGGTATTTTTTTCATAATTTTTCA
AATCATTTTCCTCACTGTTTACAAGTAACCCATTAAAAGCTTAACACTTAAATCTTTTCC
TTTCAAAGATCCTCCTCATCACACATTCACACTGGTTTTTTGTTGTAGATTTGCACCTGT
GTGTTGGGCTGGAGCCATTTGAGTTTTTGTCATTGAAAGCGCATGTAAAATGTCAGTTTT
TTTGTGGGGAACATGGGTGGATTAAAGGGGAAAGTGTAATGAGTCAAGTGGACTGCTTGG
AAAAGAGGGAAGAAATAAAAGGTCAATTTGGTCCCTCTAACCTTGACAGTGTCCCTTTAA
ATATTTCTCTACCACATGCCCTGGACCCCAGTTACTGAGGCTGAGCACTGCATACGTTCT
CAGTATGAACTCCTCCCCTGTGGTACTGTCATCTTAGCTGCAAAGATTAAAGCTTGTCTA
AAGCCGTCCAGGTGACACTGGAAGAGCTTTAATCTGTCCCGTTTGCATTCTTATACACGT
ACTGGCACATTCTGCCCTACTTTAGAGGCATGTGATCTAGTCCCTCTTGCTGTTTTAACA
GCCTCTTTAAGCATGTTTGAAGGCACATACCGAAATATCAACTTCTCGTTCTGCAGAAAA
GACAGTTGCACATTGTATCTGTGGTCAGTTTAGATGACAGCTTTGTAAAAGTGTAGTTGC
TTCCTTTTTGAAAGAACTAAATCTAATCTTCTATAGCTATCTTTTTTAGCATGGTTGCAG
GAGTTGCACTAGAAACAAGTTTCTGAGCAGAATTGTATTATTCAAGTTCTCTCTATATGA
CCATCAAATCAGTGAGGGAGTGTAATCAAGAAAGTAAACTTCCTGACAGGAGGGTCTTTG
TCATCTACTGTCATAGCTCTGTGATCAAAACAAATAGGGACACGACCACAGGCTGTCTTT
CTATCCATGGAGTTGAAAGAGTGATGTTTTTGATCCACCAGATTGTAGGGCCAACCTAAT
ACATAAATGACTGACTCTTGTCTCATTTCTCAACACAAACCAGAAGATTCTTTGGAATTT
AGATTTTCTGTAGGTGAAGGGTGATCCTCTAATTCATAAAGATGGCCTGATCTCATCTGG
TGTAGCCTTTTAGAACTTGATACTTCAAGTGTGATTGTGATGAACTCATCTTTGGTGCTT
GTCATAGTCACAGATGCACAGGAATGCTGCCATGCCCTTCCTTGCTTTTTAAATGTTTTA
GTGCTGCACTTCTTGGCAGATTCTTTTTGCACCCTGACAGCTTATCTTGTGAAGTCACTT
GTGTGATCAGTGAAGAGCAGAGGCTGGAGCTTCACACTCATTTGTTGAGCCTGCAGGGCA
GGAACTGAGGAGTTGGAAGCAAGACTGGAACCATACTGTGAGANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGATGGCACACAG
TGTACTTCAGGATGTGTGGTAGCATAGGCAGGACACGGTGTGGCCTAGGGCCTGGTCCAG
CTTGATGAGCTGCTTTGTAGTCCTCTTAGTCTACAGCAGTGAGAAGCCAAACATCCTGGT
GTCTCAGTTACTTACAGTCTTATGATATTCAACTCTGCAGTTATTAATCTGAAAAATAAA
GATGCCAGTGTGGTGTTCTTGATAGGCATGAATTTCACTTTTCTGTACTTCCACCTGAAA
TTCTGTCGTCTTTGAGGGGAAGCACATAGTTGGGGCTTCCTTTCTCATCCTGCCCCTGTT
GAGGAAGGGCCTCAGGTGTTAATGTAGTTTTTGTTCTCTGGGACTTTCCTAGTGTGGTGC
GTGCACTTCAGCCCGGGTCCTTAGCTCAGCGCATGTCTTCTCGGTGCACCTGGTGCTCCG
TGTAACTTCAGCCAGCACTGTTTACAGCCTGTCGCTGTTGATTCAGGTGGAGTCCCAGCT
GTGAGAGCAGAAGTGGCAGAAGAGGGAACGATAGGACCAAAACATTTCATAATCTCATTT
AAATGGACTTAACCACTTCATAGAGAAGAAAAAAGTCATTGTCCTCAAAGGTTTCCCCTT
TGAGATACATATTTTGATTTGCTTAAATTCTGAAGCATTTGTGTCTTCATGGATAGTTAC
GTTTAGTCTTATAAGGACCAACTCTGCTGTACTTTGGATTTTCAGGTTCCTAAAGAGAAA
GATGAAATGGTAGAGCAAGAATTTAACCGCTTGCTGGAAGCTACATCTTACCTTAGTCAT
CAGCTAGACTTCAATGTTCTCAATAATAAGCCTGTGTCCCTTGGCCAGGCACTGGAAGTT
GTCATTCAGTAAGTACTTTGATACCACCTGTATATTGAATTACTTGTTTTAAGTTTCTCA
GTAGTCTTATTTGAACTGGCTTTTACTTTCAGGTGAAATTGTTGAATCCCAAAGTAAAAA
CTTTTAAAACAATTACATCCTTAAGGACCTTACCAACTCTAAAACTCACTGTTATTGTAC
GACATTGTTACTGTATTTAACATAGTATGGGTAGTAATTTGCCACCAGCCATCTTTCTTG
CTTCTAAGCATTTAAAGTCCATTGAGCCTCGAAGTCTCTGACTGCTGTTGATGGGCACTT
GTCTGGTGCAGCAGAACTGCCTTTGCACCTGGGGCACACATGTTCTCTCTTGTAGGTTAC
AAGAAAAGCATGTCAAAGATGAGCAGATTGAACACTGGAAAAAGATAGTGAAAACTCAGG
AAGAACTAAAAGAACTTCTTAATAAGGTATGATCCTATATTTTTTCCATTAAAGAAGCTA
CAATAAGGGGCAGAGCCTTTAAGCTAGAAATTTTGTAATGAATTTTTGTCTCCATGAAAA
GAAAGGCTGCATATGGGACACATTATGATTTAAAAAGCAGCTAGTGAAAGGCACGGTTTT
GTCTGTCTGTCTTTGAATCTGACTCCACCCCTAAAGTGTTACTAAGGGAAGATCTTCCCT
CTATGGCCAGTTCCTTTTAGCTCTTCAGCACAGGCTTCCTGCTACATTCTAGATTTGAGG
CAGATCAGTGGCTAAGTTCCCATTAATGCAGGCTGACAAATCAGTTCATTGCCGCCCATT
GCTCCTCTCAAGGTGCCAGCATCTCCCACCTCCATCCGCAGTGTGGCTTTTCTCTGTAGC
CACTTCCTGGGCTCCAGGTTCCAGATCCTTCAAGGCTGCCTGGGTGTTTCTCTTCATCTT
GCCAGCTACAGACATAACATCCAGCTGGGGAGACGCCCGGGGTGGGAGTATACTGATCGC
ATCTCTAGGTGTGAGTTATGACTGGACTCTTGCCTCACTTTCACTCTGCCTCATTTCTTC
ATCCTGTCACATGAGGAAGTCCCCAGTCACCTTCTCTGTGTAACTTGTGAACTGAGGAAT
GGCTGGAGAAATGCCAGCCAGCAGGACCTATGCAAAGCCCTGACCTTGGCTCTTACTACC
AGGCTTGTCCTCATAGTGCCACCAGAACCATAATGAAACTAGCGTTAGGAAGGTTCCATA
AGGGTCTTGGTGTGTTGACCCTTTACATATTTAAAAAACAAATCATGGCTGTTGGTTCCC
CCAAGTTAAATTAAATTGGTGGTAGATTGTTTTAATACTTTATTTTTTAAAGTGGAAATT
CCTTCCTTCTTGTCTGTGTTGATAGAAGCCAATCCTGCTTACCCAGTAGTATTATGACAC
CACTGGGTTAAGCTCTGCACTCTCCCTTCCCCCATATTTCCCATGTGGCATGATATAAAA
CAGGCATTAAGAATTCTCAAGGCCCTGCATGACAGTTTAAGAGAGGAAGCGTGAATTACA
TTGCTATCTGGAATACTGAATTTGTGCCTTTCATCTTAGATGGTAAATTTGAAAGAGAAA
ATCAAAGAACTCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTCTCCCTACTTATATTTTAATATGCAACAATGCTTAAATACCCAAACATTATC
TTTAAAAAGGTGTTCCTTCTCCAGAAGATACAGTAGATGAAAATTGTCTTTGAGGGGGCT
GGGGATTTAGCTCAGCGGCATAAGCGCCTGCCTTGGAAGCAGGCAGTCGTGGGTTCGATC
CCTGGTACCGATAAAAAGGAAAAAGACAAAAAAAAAAAAAAAAATTGTCTTTGAGTGCGG
TACAAAGTGCTGCTTTAAATTTCCGTAATCCGAGAGACTAGAAAGAGATTCTGCTTTGTT
TCCACTGAAGTGGGACCGGGACTATGTGCTGCTGAGGTGTTCTGTGTGCTCTGCCTTTGT
TCTGATGTCAGGGATGCCATCCATCCTTGTAATAAAAGTCTGTGCTGTATTTAAAAGAGA
AGTTTGTGTCTCTATAATTTGTATTCTGAGGTGAACTTGGCACACTGCTCGAGACACCAG
GGTTAAAGCAGTTAATAAGACAGTAAGATCCTATTCTGTCATGTATAGTTTTTCTCATGA
GGCACAGTCCCATACTTTCCTAGATTCCCCTTCGTTTACCAGAGCCACCTACCTCAGCTC
GTTGGGAACAGCTATGATGTCCATTACTAACCCTGTGTTCCTTGCTTTTATTTTTTAGTG
ATGTGTATCTATCATCAAGAGACAGACAGATACTTGATTGGCATTTTGCAAATCTTGAAT
TTGCTAACGCCACACCTCTCTCTACTCTCTCCCTTAAACACTGGGATCAGGTAAATTTTC
TTTGTTGTTTACTTTGTTGCATATGTCTCAGAGGACTCTGGAGAAATTCTTAGTTTGTGT
ATATGTTTGTTTTTAGATAGCTTTAATAAAATATTATTTATATATAGTGAAATTCCAGCC
ACCTTAAGTGAACAGTGTGATTGATTGCTAGACTGACTTGATCATGAGCTGCCACAATAA
TCAAAATACATAGCATTTGCATCATGCTGCAATTCTCTCCTGCCCTTGTGCAGTTCAGCC
CCCACCCTCCAGCTCTTGGTCCCAGATAGCCACTGATTTGCTCTCTGTGACAAATTTTGC
TTATTCTGCAGTTTCATATAAATTGCATCGTGTGGCACTTAGCGTTTTGTATGTGACTTG
TGTCACTTAGCATGGAGTTTCTGAGACTTAGCTTCATGGGGGTCACTAGTTTGTTCCTTC
TCATTATTTGATAGGTTTCCATTGTGTGGCTATACCACAGATTGTTTATTCATTTGCTGG
TGCATTGATAAACATTGGAGTTGTTTCCATTTTTTAGCTTTTAATGAAGCTGCTATATGT
TTGTTACTTTCTCTTGAGTTAAATATGTAGCAGAATTTCTAAGGTCTCACAGAAAGTGGA
TTTTTAACTTTAAGAAACTTCTCCCAAACTGCCTTCCCACCAGTTGTACAGGAAAGTTCC
ATTTGCTTTACCTCTTCACCAGTCTTGCCTAGTGTCTGGTTTTGGTTTTTGTTTTGTTGG
TACTGGGGATCAAACTCGCAACCTCATGCTTGCCAGGCAGATGCTTATGCTGCTGCGCCA
AATCCCTGGCCCAAGTGTCAAGTTTTAAAATGTCAGCCATTCTCCTGGGTATGGTAGTAC
TTGCATTTCCCTGCTGATTGGTGATGTGGAGCGTCTCTTCCCATGCTCATCTGCCCTTCA
TGTCTCCTTGAATAAAATGTGTCTGGATTTTTTGTCCGTTTAAAAAAATCCAAAAAATCC
AAACTGGGAACAGTGACTGAGTACAGGAGACTGAAACCAGCCTGGTTAGAGCGAGACCCT
GTCTCAAAAAACAGTCTAGTTGCCTCCTGGTGAGTTGTAAGAGCCTATTATGTTCTTTAT
ATTCTGCCCAGAAGTCTTTGTAAGATGTTTTGCAATTATTCCTCTAGTCTGTAGCTTGCC
CTTTTTTCTGAATATAGTCTTTTATAGAAAAGGTTTATGAAATCCCATGTATACTTTTTT
GTTTTGGGCCTTATGTTTCTTTGCTTTTTTTTTTTTTTTTTCTTCTTCTTCTTTCTTTTT
TGTTGTTGATGTTGGGGGTTTACTCCAAGGTCTCACTCATTTGTGCTAAATGTGTTCGTT
TATCATACCACTAGGCCAAATCCCCAACCCTTGGCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTAGGATGATGACTTCGAGTTC
ACGGGCAGCCACCTGACGGTGAGGAATGGCTACTCCTGTGTGCCTGTAGCTTTAGCAGAA
GGCCTCGACATTAAACTGAACACAGCAGTGCGACAAGTCCGCTACACAGCTTCAGGTATG
TGGTTGCTGCGCAGGTCAGACAGCGACCCTCCCTGCGACAGAACTTCTCTTTCAGTGGGT
ATGACGTGCATGGCGTGTTCCCTAAGATTTTGTGAAATAGTAGAGTTTTATAAATGATAG
CTTCTGTTACATTTCTAGTTGGTTGGCCTGTGATGACTCTCAGGGTTCAAACGCACCTCT
TTTGTAAGCCTAAAAATTGAAGCAATTTTTAGGGGAACTAATATGTACTAAGTAGCCAGT
GAGTTTGGATCTAATTTTGCTAAAATACGATGTTTTGTGCCCGTATACTCCAGCAGGTTC
CTCTCCTTACATTTTGCCATCTCTTTCTTGATCTTTGGGTCTGCTTTGGCCCTTCGGTTC
AGAAGGGCTGATTTGTGCAGACTGGTTCCGTGTTCTGGAGGAAGAAGTCCTGCCGATAAG
TTGACTTCAGAGATGGAATTGCCCTGTGATTCCTATGGGAATAGGCTGAATGCTCTTGTT
AATTTCAGAGTGCATTTAATACAGAATGCAGAGACTTGTACACTCATTTTGAAATTAATA
GTTTTGAACTCAAAATAGCTGGTTACCCCTGTAAGGGTCTTCATGTGACTACCTGGGCAT
AGGTAGAGATGGAGCCACTAAACTTTATGGCTCCTTTCCTAGAATTGTTTCCCTCGTCAC
AGACACGCACAAATTATAACTACCAGGTTTTCTGTTTTCCCATGAAGGGCAGCATCTATC
TGATGGTGTTGAGGTCTGTGACCTTCTGCCAGCAGATGGGAGAACAGTGAGAATGACTAT
AATGTCATTTTCCCTAAATCTGCAGCTGTAGAAAGTGGGCATGTACTGAGCTTTCATACT
TACTTTGAGCTATATGTATTTGTTAATTATATAAAAATTCATTTAAAAACAGAAGTAATT
TCAGTGCCCTCTCTGAGGCCAGCTTTGAGCACATATTCTGACAAACTGGCATTCTCAACA
GGCCCCACAGTTGGAGGCTGGGTTCTGAAGAGCTGCACCATTCTCTGCGTGTCATTCTTT
GTCCTTAGAGAACAGAACCAGGTTTTTATTGTTTTTTTTTTTGTTGTTGTTGTTCTGTTT
TGTTTTTTTGAGACAGGCTCTCACTATGTAGTATAGGCTGGTCTTGAACTTAAAGCTTGT
GTAGGCCAGTATGGAATCAGGTCATTTGGGAACAGACATATTACTGTTAGTTTTGGTGTA
AATTGCATGATTTTGGTGAGTGACGGGATCATCAGTATATTAGGAGGGCAGGCTGCTACG
GAGGCAGCTGTGCTGTGTGGGTGTAACCCTTAGCGGTTCTTTCCTTTGTGGCCTGTTTTC
TTACATGAGGAATGAAGATAACAGGACCCGTCTGGTGATGTTGCAGAGCTAGGTGAAATA
GCAAGCAGGTCCTATTGTGTACTGTGTTTAGTGTCCTTTTTAATGCCACCTTCATCACCG
TCAGTCTTTTCCCATCAACATCTGTAGGATGTGAAGTGATTGCAGTGAACACCCGCTCCA
CAAGTCAGACCTTTATTTATAAGTGTGACGCAGTTCTCTGTACTCTTCCCCTGGGTGTGT
TGAAGCAGCAGCCACCAGCTGTTCAGTTTGTGCCACCTCTTCCTGAGTGGAAGACATCTG
CAGTCCAGAGGATGGGATTTGGCAACCTTAACAAGGTAATATGTTCTGGGCCCCTGTCCC
CACATACTGATGTGCATATCCTAGTTTTTCAACAAGCAAGAAAACTTTGAGTTTGTGTGC
GTGCTTGCGTTCTCAGATACAGGTCTGAGGCCTGTTAGTTTATTCCTCTGCCTGTAGAAT
CCAGTGTGGTCTCATGACGTCATTCTACACATCCAAGCCTATGAAAAGAGAATCATAAAG
TCTTAAGTAATACATTTGTAAGGGAGATTACTAAGCATAGGAGGACCAGGAGACTTCAGT
ACATCTGAAGAAGTGCTTCACAGGCACAGCAACGCTTGAAGAAAGCCTGTATCTGAGACC
TATCCCTGCTCACTTCCCCTTTCTTATGGTAGGTGGTGTTATGTTTTGACCGAGTGTTCT
GGGATCCAAGTGTCAATTTGTTCGGGCATGTTGGCAGCACAACTGCCAGCAGAGGGGAGC
TCTTCCTCTTCTGGAACCTCTATAAAGGTAACTGCTTCTAGTTTCCAGGTTTTTCTTGGT
TTTTTGTTTTGTTTTCCAAATCCTTTTAGGAACACAAAATGAGGAATATTTAGGGTTTTC
ATAAATGTATGCCTTAATTTTCATTAACTTGGGAGTTCCTAAAATCCCTTCTAGGTATAA
GAGAATACCCCAGGAGATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTCACACAGCAG
AAGGGGTGGGCCCCAGGAGGCTTCCTGGAATAGGAAGTTTATTGCTCATTTTCTGACTGT
CACACCCAAACTTGGCCCGGGAATCTTTGATCACTTTCTTTAGAATGCATTTTCCACATT
CCTGTCTCCTGTTATTTTTCTTCTGTAATTGGACTATACTTAATTTCTGTATAGAGGTAA
ATACAGTATCATTTATACCCCACTGCACTCTCAGATAACGGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGATGACTGAT
TTGTCCTTGTTCCAATGGGTTCTGCTCATTTTTTTCTTTAGCCCAAAGGAAACTGTGGTG
TCACGCTGGCGTGCTGATCCCTGGGCCCGGGGCTCCCTACTCCTATGTAGCCGCAGGATC
ATCTGGAAACGACTATGATCTGATGGCTCAGCCAATCACTCCTGGCCCCTCAATTCCAGG
TGCTCCACAGGTGAGAAACCGGCAGACTACATCTGGGTCTCTTGGGGTACCACCCGGTGT
CCCAGGATCTTGGGGGAAAGATGCCACTTTTGCTTTGATTTTAGTCATTTAGACACTTTT
CAGATAACCTGAGAAATCATATTTGTATCTGATTTCTCATATTTTAGCTTTGTAAATCTA
GGCAGTCTACATTCGAAGTAGAAGCATCCAGAGTAAAAAGAAGTCAGTAACTTTTTTCCC
AGGGTTTCCCTGCCTTAAAAAGCAAAATCCATTTTAAATTGTCCCTCACTTTGTAGTGAC
TCATAGGATTATGGGGTCTCAGGATCAGTAGGGGCTTCAGAGCATACACCCAGGAAATAG
CCTCAGATCTAGAGTATGCTAGACCTTGTTCTGAACAGTAGTTAAGGGTTCCTCACTGTC
ACAGCCCTGGATCTGTGGCCTGCTCTGAACTGAGGTGCAAGTGTTTTCCTGAGTAAGAAA
GTAAGACCCTAACCTTGCTGCCAGTAGGTACTTCAGGGGATAAAGAAAATCCTAGAATTT
GGTCGTCAGCGTACTGCTAAAAGAAAGATGCAGTTAATAAGCACCACCCTAGACATGACC
CTGGGTGGGTGTTATTGCCTCCCTCTGTCAGGTCTAAGAAAATATAGATGAGACCAGCGG
GATGATGAAATAGTAGTGAGGCAGGGGGTGTAAGCCTTCAAGGCCAACAAGAATTTGGCA
GTTCAGACACAGAAGCTGGGTGTGGTGGTGCACGGTTGTGATACCTGCACTCTAGGAGCT
GAAGGACTGAGTATCCAAGTACAGTTGCGGCAACTTAGACCTGTTTCCAAAATGGAGGCG
TACCAGGTAGCTCATACTGGAGGAGGCCCCAAGTTCAAGTGCCAGTACCACCAAAGGAAA
AGCATAATGAAGATGTGGTTTTCCAGCAAACTGGAGAGCTGAGACAGGATGATGAATGCT
GGTTTTTAAAAACCCGGGGTGTATTGTGATCTGCTTCTCCCCTGAATAGCCAATCCCACG
CCTCTTCTTTGCGGGAGAACATACAATCCGGAACTACCCAGCCACAGTCCATGGTGCTCT
GCTGAGTGGGCTGCGAGAAGCAGGAAGGATTGCAGACCAGTTCTTGGGAGCCATGTACAC
TCTGCCTCGCCAGGCCACGCCAGGTGTCCCTGCACAGCAGTCCCCAAGCATGTGAGACGG
ATGCACTGTGAAGGAGGGCGGCTTTGGGTCTTCACTGTGAGTGTTGCAGCTCTTCTGGCA
ATTCCAGCTGGCACTGAGAAACTCCTGCCCTGGCACCTGGACCCACTATTAGCAGGAATC
CTTAAGTCTTCTTAAAGACAAAGGCAAGAAAGCGCTATAAAACATCTCAGTCTCTTGGGT
TTTGTTTTTATTTTTTAATATTTTGAGAATAAAACTTCATATAAAATTAGTCCTCTTTTG
TTTCCCTTTTGGGTTAGAGTTGTAAGGAGTGTTACTTCTGTAGAATGCCAGCATAATATG
TCAGTAGTAATATATTTTGTGCTTTAAGGCAAATGTTCTTACTAAGAGAAAACCAGTTAG
ATCAGAAAATGAGGTTGAGGGGATTCTGTAGATGAGGACTTGCCTGACTTCTCTGCCGGG
ATTGTGGTGACAGGCCAAGAGTGGATGGTTTGGGACACTGGCTTCACTCTGCCTTTATTC
TCAGATCCTTTCTATGGGCATATACGTACCGGACCGTAAGGCTGGGGAAATACTACCTAA
GGGCGAGGGCAGGGGCTAAGGTAACTTAGCTGATGTCACACACTACCACAAAGTGACTTA
ATACAATAGAAAGTTTCTGCAGTTCTGGATGGCCAGAGTCTAAAGATGGCAGTTTGAAAG
TGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1075, 4777..4942, 17707..17766, 24476..24609, 27622..27700, 28250..28342, 29703..29809, 30833..30914, 32069..32163, 32264..32275, 39945..40087, 40435..40525, 41619..41753, 42324..42397, 43618..43729, 46722..46854, 48327..48514, 48872..48986, 50351..50478, 51461..51467, 51469..51515, 51517..51609, 52609..52794
1001..1075, 4777..4942, 17707..17766, 24476..24609, 27622..27700, 28250..28342, 29703..29809, 30833..30914, 32069..32163, 32264..32275, 39945..40087, 40435..40525, 41619..41753, 42324..42397, 43618..43729, 46722..46854, 48327..48514, 48872..48986, 50351..50478, 51461..51467, 51469..51515, 51517..51609, 52609..52791
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved