Cavia_porcellus Locus RPL4
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPL4
Cavia_porcellus
RPL4
GeneScaffold_5844
SNORD18, SNORD16, SNORD18
1219..1291, 1626..1724, 2471..2541
4163
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTAGCAGTAGCAGCGTTCAGCCGTGCTAAACGCGGAGACCTGTACAGCCGGAGAGG
GAGGGCAGTGCTCCATTTCTAAACAGCTGATGAGAGAAAAGCGCCCTCAAGCATGCGAAG
ATAATTCTAGGGGAGGCCTTCAGGTGAAGCCCGGGTGAAATTCTAAGTGTTTCGAGTGTA
ACAGTTTATTGAGGAACTAATACAGGCCTGCTAGTGGAATTTGTAGCTTAGGTGTTTGAC
TGATGTTTCGACTTTAAGCATTCACCTGCCCGTACTGTGTTGTGTAACATTTGACAGAAC
CCGGAGAGTTGCTTCTCATATGTGTCTCTTTCCCCTCCAAGGCTTGTGCTCGTCCCCTGA
TATCAGTGTACTCCGAAAAGGGAGAGTCGTCCGGCAAAAATGTCACTTTGCCTGCTGTGT
TCAAGGCTCCCATTCGACCAGATATTGTGAACTTTGTTCACACCAATTTGCGGAAAAACA
ACCGGCAGCCCTATGCTGTCAGCGAATTAGCAGGTATGGATTTGCATTTTTCTCGGGATG
GTGTTTTAAGGCCCATTCACAGTCGTGATGAGATTCCACTCCATGGGTCCGTGTTTCTGA
ACCACATGATTTTCCTAGGATGCTCTGATGCTGTCTGTTACCATGCATAAGTCATAGCTT
GGGCAACTACACAGCTAAAAGCTTTTTCTTCCCAATTTTAGGTCATCAGACCAGTGCTGA
GTCTTGGGGGACTGGCAGAGCTGTGGCCCGAATTCCCAGAGTTCGTGGTGGTGGAACGCA
CCGCTCTGGCCAGGGTGCCTTTGGAAATGTATCCTTTGTTTCATGAGACTGGTTGTGGCT
TGTGGAATTTAGCAGGCTGGAACGGGGCTGGTTCATATTAACATGTGCTGCAGCATCTGT
GTCCAGAATGCTTAGTGTCCTCAGTAAAAAGATGTTTTTAAGGGATTCGCATAGGGAAGT
GCTGCTTGCAATGATGTTGTAATTTGCGTCTTACTCTGTTCTCAGCGACAGTTGCCTGCT
GTCAGTAAGCTGGTTCAGAAGATTGACGAAATTTGTTACTGAGCAAGATAATAGATATCT
AATTCCTAAGCTACACTAAGTATGATTCTTAACTAAGAAAACAGATGTGTCGAGGGGGCC
GCATGTTTGCACCAACCAAAACCTGGCGCCGCTGGCACCGCAGAGTGAACACAACTCAAA
AGCGGTACGCCATCTGCTCGGCCCTGGCTGCCTCGGCTTTACCAGCACTGGTCATGTCAA
AAGGTTGGTGATGGTTTTTCTGCATCAGAGTAGTGATTTCATCCCATGGTGTCCTGCTGT
AAAGTGCCTATCACTAGCAAGGAATGTAGCTTAAAGCGAAATTCTTCCTTTTAAACTCCC
CTTATGTTTCTTGTGGCATTTTAAACTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGATTCTAACTAAGAAAACAGATGTGTCGAGGGGCCGCATGTTTACACCAAC
CAGTACCTGGCGTCGCTGGCACCGCAGAGTGAACACAACTCAAAAGCGGTACGCCATCTG
CTCGCCCCTGGCTGCCTCGGCTTTACCAGCACTGGTCATGTCAAAAGGTTGGTGATGGTT
TTTCTGCATCAGAGTAGTGATTTCATCCCATGGTGTCCTGCTGTAAAGTGCCTATCACTA
GCAAGGAATGTAGCTTAAAGCGAAATTCTTCCTTTTAAACTCCCCTTATGTTTCTTGTGG
CATTTTTAAACTGAAAATGATGAAATTCCACATATTGGTCCGTGTTTCTGAAACACATGA
TATTTGTGGAAATTCTGATATAGTAAATCGCATGTCATTTTGCTTTTGTGGGTTATTGCT
CAAGTGTTAAGTTTTTCAAAAACATTCAGATAACGAGGTCAGTCTTCAATTGACTTTATC
AGGTCATCGAATTGAGGAAGTTCCTGAACTTCCTTTGGTGGTGGAAGATAAAGTTGAAGG
TTACAAGAAGACTAAAGAGGCAGTTTTGCTTCTGAAGAAACTTAAGGCCTGGAATGATAT
CAAAAAGGTAGGTCCTTGTGCATATTTACAGTTGGGTAGGTTATGCTGTACCGTCTAGAG
AATAATGGCAAGAAAAAAAGGTATACACATCCATTACAGACATGGTGCTTTTCAGAGTGT
CTCTTTTGTAGATTTGGTTAGTTGGCTTGGGAGTGTAGAACTAGCAGATAGAGGACAGCT
CAGCATAGCGTGCAATAGTGAGAGCTTTTTAACCAATCTCAACTTGGTTCAACTGCTGAG
ATCAGCCCCTAATATCAGAGCTACTGGCTTTGTAGGTCTACGCCTCTCAGCGAATGCGGG
CTGGCAAGGGCAAGATGAGAAACCGCCGCCGGATCCAGCGCAAAGGCCCCTGCATCATCT
ATAATGAAGACAACGGTATCATCAAGGCCTTCAGAAACATCGCGCGTGAGTCTTCCCACT
TGTGTTGCTTCTCTGTATGGTGCTCACACACTCAGCCTTGATGATGAGTACCACTTCATG
GGACGTGTTTCTGAATTCGATGACATTGCGGACAATCTGACCTTGTGTGAACGAAATAGC
TTGATCATTCTATTTTGAAACTTCACACATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1172, 1361..1467, 1784..1922, 2642..2766, 3035..3163
1001..1172, 1361..1467, 1784..1922, 2642..2766, 3035..3163
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved