Cavia_porcellus Locus GNL3
snOPY snoRNA Orthological Gene Database
Cavia_porcellus GNL3
Cavia_porcellus
GNL3
GeneScaffold_5275
SNORD19, SNORD19, SNORD69
4155..4210, 5372..5445, 6564..6640
9196
TACTGTAACACATGGATAAAAGTCTTGGAAAACAAGATTCAAAGGTAAAATAAATAAAT
AGAAAAATATTTATACAATAATCCTATTTCTCAGAGAAAAATCATCCTTTATCATGTAGG
TTGTTTTTCATATTTATGCCTTAGTTACCTACTTTCTTAAGTAAATGTGAACAAATCATA
TATACTATTTGGTAGCCTATGTTTTAACTAAGAGAAAATTCTTCCAAGTTAACGTTCTTC
CTCATGCTTAATGGTCTGATAGCACTTAATCATATACACAAATATACCACAATTTACATT
GGATGTTTCAGTAAAGAATTATTAATAAAGGTATTTTGTATACTCTTAAATCCCAAGAAA
GTTACCAAGGCCCTTCCATTGACCCACACACATATTTGCTACAGTTTTAACCTCAAGTAT
GTCTTCAAAACATACTTTCCAATCTTCCATTTTGGATCTTAAGATTCAAATTATGATCAA
ATGGTTAGCAACTACCAAAGCAAAAACTACATTTCTCTTTAATATTTGTATTAAGTCCAA
AATACTTCCAAGCCGTATTTGGAGAAAAGCGTACTCCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTGTTCCCAGTGCCCACCATGAAACGGCCAAGTAAGG
GGGGTTGTGAGGCGGGACGTGGGAGAGCCCCTGTTTCAGGTAAGTTGTTCTTCCGCGTCC
GTTCTCTGCGCAGAACGTAGGAAAGCGAACTGTAGGTAGGCCCAATGTCTGGAGCCGCGT
GGACCTGAGGGCGGGGAAGGCCCCGCGTAGATTCGCGGGCTCGCTGTACAGCACAGAGGC
CTTCCCCGAGGATGGAGACCATCCGCGCAGATTTTTACGGGCGGCAGCATCTGAACTTGG
TTTCGGATCCAGTATTTCATCTTCTACGTTAGCTGAGAACCAACTCTTGAAGGCGTACTT
AGTTTTGTGAAATTTTTTTAATGCGGATTTTTACGATTATTAAAGTTAGGAAAGGAAATA
GCCTTCCAAAATACGTGTGGGTCAGTTAATAGTAGGAAAAAGGAGGAAGTTTTGCATTAT
GCAGAACGCGCCTCTAAAAGCTAACAGTGGGCCTGATTAGTGATTCTTTTTTGTTTTTCC
CCTTACGGGGGATGGAACTCAGGACCTCGCGCTTGGGAGGCAAGTGCTTATACCGCTGAA
CTAAATCCCGGACCCCTGATTGATAATTCTCTAGCCAAAGTGGTGGTCGCTTTAGAAATG
GGCTTTTGTGTGTAATTTCTGCACTGTGAAAAGAGGTAGGCATTGAGAACTGGCTCCATC
CTAAATATCTTGACTCAGTGGGATTTGAAAGTGGCATTTTTTAAAAATTAGGTGCTGTAT
GTCAGTCTTAACATAAGGTTTGATACGTAATTCCTTTGTTTCTGTATAGAGTTAAAGAAA
GCGAGTAAGCGCATGACCTGCCATAAACGTTATAAAATCCAGAAAAAGGGTAAATTTTTC
GTGGGATACCTTTACCAAACATGCTGCTGATTTGATTTCTGCTCCATCTCCTTTTCACTG
GAAGTCTGGATTAATAATTTAGGGACTGGTAGACCATGGGCATCAGGAGTGCACCTGTGG
GGAAGTAACCTGTAAATTTTGGTTAACATAATTTTTTTAAGCTGGGTGTGGTGGCATTCG
ACCATAATCCCAGCACGTGGGAGGCTGAGGCAGTATTGCTGGGGAGTTCAACCCAGCTTG
AACATCATAGTGAGGGCCTGTGTTTTTTTTAAAAAAAAAAAAAAAAAACAAAACAAAACA
CTACATGATTTCTTTTGGGAGTGATTATTATTTTTTTTTTTGGTTGTTTTATACCTACAC
ATACATACATGTTTTGTCTGTATGATTCCAGTTAAACTTTCATTTTTCCGGGATTCCGGG
ATTTTTTTTGGAGACAGGGTCTTACTGTGTAGAATATATAGATTAATGTTGAATTTCTTA
TGTAGCCCAGGCTGACCTCTGACCTCAGACTTGGAGCAATCCTGAGGGCTGGGATTATAA
GCATGCACCACCACACCTGGCCTTTTCTAAGACATTTTACAGACACATCTATATTACAGC
CACGTTGATTTCTCACTTAGAATTCTTAAAAGGAATATAGGTTTGTTTTGTTTTCCAAAT
AGGTTCGAGAGCACCATCGAAAATTGAGAAAGGAGGCCAAAAAACGGGGTCACAAGAAGT
CTAGGAAAGACCCAGGAATTCCAAACAGTGCTCCCTTTAAGGAGGCTCTTCTTCGGGAAG
CTGAGCTAAGAAAACAGCAGGTAGGTTAATCAAAACGTTGATCTGTGATGTGGTGTGGGT
ATGTATGGTTTGTGTGTATGTTTGTATATACACTTTTAGTCTAATGGAGAAATTTGTACA
CTTTTTAAGTAAGGTAACAGCATCAGTCAGTCTCTGGCTAACTTTATCTTCTGGACACAG
CTTGAAGAATTAAAACAGCAGCAGAAACTTGATAGGCAGAAGGAACAAGACAAGAAAAGA
AAACTTGAAACTAACCCTGCTGATGAGCCATCTAACATTGAATCTAAAGAGGTAGGATTT
CATTTCTTTCAAGAAATGGTGCATATCTATAATCTCCACACTCTGGGAGGCTGAGACAAA
ATTTTCAAGCCCAGGCTGAGCAATTTAGATGAATTTTTTTTTAAAAAAAGACTGAGAATG
TATAGCTCATAAAGGACTATGTTCAGACTCCTAAAAAATTAGCCAGGCGTAGTGGCACCC
TCCTGTAATCCCAGCACTTGGGAGACTGAGGCAGGAGGATCGATGTGAGTTTGAGACCAA
CTTGGGCTACAAAGTGAGCTCAAGGCCAGCCTAAATTGCATAGAGAGACCCTGTCTCAAA
AAGACCCAAAAAAAATTTCCTTGCCACTAATTAATCAGCTATGGAAAACATGAAGAGAAT
ACAAGTTACAATTACTAGTATGTCAATTTTGTGTTTTCCCCTTTATATTATCTAGGAATT
TGGACAAAGCAAAACTAAGCGACCCAAGCTGACCAAACAGAGTCCGAAGACAGTCCATTA
TCAGGAACTTAAAAAGGTACCTTTAATCTAGGTCAGTGTCTAAAAATGGTAATGAGATTT
AAAAATAGTCATTCCCTGACCTGGTATCCCTATAAAGTGGGAATTCTGCAAACTTAACTA
ATAGGAGGAGGATGATTATGTTCTTGATGATGCTGCTTTCAAGTGCTGTTACCCCAACAC
ACATTTCCTACCTATAATTAGAACCTTACAGAGGAAATTCCATGTGTTAGTTTTGGGTTT
GGTTTTTGTTACTTTTAACCACAGGGTCTCACTGTGTAGTGGTAATCCTCCTGCCTCAGC
TTCCTGAGGACTGAGAACAGGTATGTGCCACCATACCGCTCTAGACTGTTCTTTCTTTGA
AATCCATGTTGATCAAAGTCTGCTAAGCAAGCTTCTGTGTTGCCTTCCTGTGGGAGAAAT
GATGAGCATTTCGGTATTCTTCATTACACGTGAAGACATGAGATCCAACTCTGAACTCCT
TGCTAGGTAAATGTTAGTAGGCTCATATTAAGGGCATTCCTAAAAAAGAAATACTGTTAA
AATTGTTCTTGCTTAACAGGTGATTGAGGCTTCAGACATTGTGCTAGAGGTATTGGATGC
TAGAGATCCTCTTGGTTGCAGGTGTCCTCAAGTAGAAGAGGTGATTATCAAGAATGGGCA
TAAAAAGCTGGTACTTGTATTAAATAAATCAGGTGAGCAAAAGGGGGGGGTGCCTGTTGT
CTTTTGTTCACTAATGAGGTATGAGGAAAACATCTGAATCAGTCTGATCCAACTCTGACC
TCAGCAAACCAGAACACATGCAAAGACAGTACTTGTCAAAGACAGTGGGGAGCAGTTGGG
AAGTGGTGGGTTGTTTTTTTTTTAACTTTTTTTTCCCCACATTTGTGAAANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGA
ACAACCTAGAGCTAGATGTGGTATCACATGCCTGTTCTCAGTCCTCGGGAGGCTGAGGCA
GGAGGATTACCAGGAGGTTCAAGGCTAGCCTGAACTACATTGTGAGAGCAACCCTGTGGT
TAAAAAAAAACCAAAAACCAGGGATAATTCACACAGGGATTTATGTGGCTTAGAAGGTCT
ATTTGGCCTTCATAAAGAAGTGCTTTACTTAAAAATGTAAGCTTCTGTAACAGTTTCTTA
TAGGAAGTGATGAATATACCAGATTACTTCCTTTCTACACAACATGAGAGTATTGGTACA
GGAACAAGATAAATTAGACTGTGACAGAGTATTTTAAATGAAATAATCACATAGTGGGCC
TGAGCAGCAGGAAGAAGAAAACCCAGAACACAGACTTGTGAAGCAGAAAGTAGGAACAGG
GTCAAAAATCATTTTTAGGAGTCAGAAAACAAGTGGCTGCAGGCTGTGTTACATTGTAGA
GCTTGACTTAATCCTAAAAAGGTAAGCAATGCAGGAAGAATTGAAGTGTACACGTTAAGC
TGTATTAAGACAGGCAGCAAAGAAGAAAGCTTGCCTTCCCATTTTCCACTTCAGTCCTTT
TATAAAACTAGGAAAAGGCAAATAACGTGAAATCCATAATTTTAACAGTTTATAAACTCA
ACAGGTGGATCAAATTAAAGCACATGTTGTGTTCTTCATTTCTATCAGATCTGATACCAA
AGGAGAATTTGGAGAATTGGCTAAATTATTTGACGAAAGAATTGCCAACAGTCGTGTTCA
AAGCCTCAACAAATCCGAAGGACAAAGGGAGGATAACCAAGGTACACTTAACTGTTAGTG
GTGGGAAGTGTTCTTTCTGATTTTGGATGGTTGAAATATGATGAGTATATGAGAAGTTGA
GTTAAAATGAAAAATAAAAAGATCCAACTCTGATTTCATCCAGAGATCGTCTGAAGAAAT
AAGAGCCCAGTAGCAAAGAGCTGGGCTCTGGTGCTAATTTCTTGAGTTTTACGTGTTGTC
AGAAAATTAAACATGTATTTAAAATTTTACCAGGTGAAGGCCAAGAAAAAAGCTTTTCCA
TTGAAAAATAATGTTTGTTTTGGCAAAGAAGGTCTTCGGAAATTTCTTGGAGGTTTTCAA
CAGACTTGTGGCAAACCTATACAGGTTGGAGTAATTGGTAAGTTTCAGTTTATCTCATTC
TACCTCTTAGCCAAGAATTTTTCCTTCTTAAGAACAAGATTATCATGAAATAAAGGACTT
GCTCAAAACTGCGCTTGCCACTTCACATCACACACAAATACAGCTTAAAAACTTAATTGC
TGCCAGGTTCAGTTCTTTACTAAGACTGGGCACCACAGGAAGTTGAATTCTAAAAGCCCT
TGTTAGCTGGGGGGATAGCTTGGTGGTACAACACTTTCCCGACATGTTTGAGGCCCTGGG
TTCAATCCCCAGCACCACATCATTTCATCACCTGGGTAAGACATGAAGCTAAGACAGGTC
AGTATTGAACTAAAACACTACAGTCCAACTCTGATGTCACTCTAAACATCAGGCAGACTT
AAAATTGGGCAGTGAAAATTTTGTAATTGCCAATATATTAAATGTCTTATATGTGTGGAT
TTCCCCCTTTTTGTAGGTTTCCCAAATGTGGGGAAAAGCAGCATCATTAATAGCTTAAAA
CAAGAACGAATATGCAATGTTGGTATATCCATGGGGCTTACAAGGTAAAACTTTTATTAC
AGATGAGTATTTTCATCATCTTAAACCAATTCCTTGTTCTTTATTTAAACCTGTCAGTGA
AAGGAAAAGGGTCAGGCCTACAGTGGGTAGGGTAGGCTTCGAGGAAAATCTGAGCTGTCC
AGTTCAGTTTAAAAGACAAATGAATTAGCTTGATTAAAAAGGAAAACTGCCTCAGACCAA
GTGTTTTTTCTAAGCCTTGAGAAGAGTATAAGAGCTTTCCAGGTAAAATACTATTATGTT
AGAAAAAATAGCTATTTGTTAGGTAGATGTAGACACTATAATGTAGTTCTTTTTAAAGGG
GTGGATATTGTTAGGTTTTAGATACCTATGAAGCAAATGATGACAAACTGGATCTGACTC
ACTGTGCTGAGTGTTTTCAATCCAACCCTGAGCTTCATGTTCTATGTCTTCCAGATAAAC
CGGTACCCAAGTAATTGCATCTCTTTTATTTTAGGAGTATGCAGGCTGTTCCCTTGGACA
AACAGATCACAATCATAGATAGTCCAAGTTTCATTGTGTCACCACTTAACTCCTCCGCAG
CCCTTGCTCTTAGGAGTCCAGCAAGTATTGAAGTAGTAAAGCCACTGGAAGCTGCCAGTG
CCATCCTGTCTCAGGCTGATGCTAGACAGGTAAAAGTGCTCCCCCTTTTTTTATTTAGAA
GATTTTGGTGATTTTTTTAAAAACTACCCTATTTAGGTAAATGATAATTCTTGTTTTGCC
TTTTTTTTTTTTTTTTTTTTTTTTTTTTAAAGGTAGTTCTAAAATACAATGTCCCAGGCT
ATGAGAATGCTCTGGAATTTTTTACTAATCTTGCTCAAAGAAGAGGTCTACACCAGAAAG
GTGGAAGCCCAGATACTGAACGTGCTGCCAAACTGCTGTGGAATGAGTGGACAGGGTAAG
GCTTATTATATAAAGGAACTGGTTTGTTGGTTTATTTTTGTTTTTGGTACCAGGGATTGA
ACTCACAACTGACTCATGCTTGCCAGACAGGCGCTTATGCCGCTGAGCTAAATCCTCGGC
CCAAAGGAACTGGTTTTTAACAGATATTTTTGTTTTAAAACCAGTGCTTCGTTGAGTTAC
TATTGCCAGCCCCCTACTTCTTGGACCCTTTCTCCGCATTTTAATGAAAGTATTGTGGCA
GACATGAAAAAGGGCTTTAATCTGGAGGAACTGGAACAGAACAATACACACAACATACAA
GGTGTGAGAGACTTGTGTTTCACTGCTATTTTCCTCTGTTGACATGCTGATAGTGGTCTC
ATCAGTTTTTGGTGGGGGCTGTTCCTTTCCTAGCCATCCAGAGCCCTTGTTCAGCCAATA
GCGTACTTTTTTATTCTTCGGGTCTGACAAATGGAATAATGGAGGAGAAAGACATACCTG
AATTGCCCGGACAGAAGAGAGAAAGAAAACAAGAGGAACGAAAGGATGTGAAAGATACGG
TTAGTGACCAGTAAAGTGTTGATTGTGAAGTTGTTAATGTAAAGTGTGTTTTCTGTGAGT
TAAAGCTGAAGTGCTTTTCCACCATTGGTACAATAAATGGGAAGGGGTTAATTAGAACAA
AGTATTATGCAGTTGATTGAAAGAAGCTCTCCATACTAAGTATTTTTTTACACATCCTGT
TAGGTGTATTTTCAAAAAATAACTGGATTAAAATGCAGGCAAGGATTACTAATTGTGCCA
GTTCTCTGTCCCATAGGAAAAGATCTCAGACATGTCACCTGTAGAAGAGACAGGAGAGGA
GGCACTACCAGAGGAACCTATCATAGCAGGTGAATTTGGGGCAAAGGACTTCACAAAGCA
GCTTGCTATAGAATTTTGTGTGTGTGTGTGTGTGTGTGGTGTTTAAATCTTCACTTTCTC
TCCCAATATAGGTGACCCGTCTATAAGACCTTGTATTATCTTGGATGAAAAGACTAAAGA
GGATGATGCTTACGACTTCAGCAGAGATTATGTGTAACAGAACTCATCATTTTATAAGGA
TTTTCTTGACATTTCAGGCAAATTGCTAACCAGTTGTATATGTATAATGTGCTGATTTTG
GTGTGGCATAACTTGTAAAAATTTTGTGAATATGTATCTTGTACACATTAAAGTGATTAA
ACAATTTACAAACTGTCCATATTTTATTGAAAAAACTGACTTAGTACAGTGAGGGGACAG
TAGTAGTTACCTGGAAGCAAAGAAATCTAAAAATGTATGTTTTACATATACATCAGGCCA
CAGCTTCCAAAATTAAAATCCAGTAGCAGTTTGAACTGGCTGTACTAGTTATACCAGTCA
TACCAGTCCATCTGGTCGGTTCACACCATAGTAAGCAAACACTTAGTAAGGCAGATGGAG
ACATTCAAAGTCCCATCTTGAAAGCTGACTACCAGATTGGACAAACTCAACTTTATCCAG
ATGAAACAATCTTTTTTCACTTCAGTTGCTACAGATAAGCATTGACGCCCATCAATTGTT
AATTCTACTTGTGCGGTCTTCCAAGATTTCCTGAGAAATAATTAACTGTTTTACTTTATG
TTCGAGAGCTCCGTATGTCTTCGGATTAGGCTGAATTTGCCTGTTGGATCTGGGATATAC
CATTTTTCCCAAATATCAGTGTATGATGCAGTTCTTCCCCATGGCTTAAAATGTCCATTC
CAGTGGAGTAACTTGGCAGCCTTTACAAACTGTGGTGAATATCTTTTTCCAGCACTGGAA
CCTTAAAATTGAGAAAGCCAAATGATTATGACAGACAAAAGCAATGCCATACCAGACTAT
AGAATAGTTAAGGGAAATGGGCTATATTGGAGCTTTCAGTAATGAGGTGGTTTTGGGTTT
TTTTTTTTTTTTTGGTACCTGGGATCAAACTCATGACCACATGCTTGCAAGACAGGCGCT
TATGCCACTGAGCTAAATCCCCAGCCCCAGAACTTTCAGTAATAACCCATTGTGGTACAA
GGTTTGGCACTATTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1013, 1789..1847, 2522..2659, 2820..2930, 3355..3435, 3979..4111, 5208..5320, 5550..5676, 6136..6223, 6694..6868, 6992..7134, 7304..7440, 7533..7690, 7694..7717, 7936..8008, 8111..8196
1001..1013, 1789..1847, 2522..2659, 2820..2930, 3355..3435, 3979..4111, 5208..5320, 5550..5676, 6136..6223, 6694..6868, 6992..7134, 7304..7440, 7533..7690, 7694..7717, 7936..8008, 8111..8193
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved