Cavia_porcellus Locus ENSCPOG00000012206
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ENSCPOG00000012206
Cavia_porcellus
ENSCPOG00000012206
GeneScaffold_7721
SNORA2
41961..42099
69542
TATTTTATATGGCTGATTGGTATATATTTTATATTTGTGATGATATCACTTTTACTTTT
TTGTCCCTTCTGTTTTCTGTTTTTGTCATAACTCAGTTGTATAATGTAGAATAAAAATGT
TGGTGTTTCATTAACTTAAATTTTTTATTCAAGTTTCACAAATTACTAAGTAATAGGAAT
ATTTTTTCAGGCAGGAGACTCTGTGTAAATTGTATATTGCAAAAAAAATGGTTGATTAAA
AAATGGCTACTCAGTAGGATGTATTAGTGAAATACAAACATAACCAAGAATTATCATTTG
AAAGCTGTAGGAATTCTTGTATTTTTAAATTGTCAATTGTATATAAAATATTAAAAACCT
TTTTGAAAATTCCTTCTAGGCTGACAACATCAACCTTTCTTGATGGACCCATTCATCAAA
TGAAATATGCTTGTACTATTTGTAAAAAGCTTTTTATCTCAACATAGAAAAGCTTCACCC
CTAAATGGAAATGAGGACATTTGATAGGCTGATTTAAGTAGTGGATATTAAGATATTCCA
TCAAATCATTGACCAGAGGATAAATATTGAATAAATTAACCCCAATACTGTTTTTTACCC
AGGAAGATTTCATCTTGAGAGAAAAAGAACTTTGTTTTCTGAAATGAAAAATGAGACAAG
AACAGGCTTAAAAGAAAATAGGTGAAGATATTAGTATAGTAAATAGCAATGTCAACGATT
ATTCTCATGAAGATATAACTCAATGATGTGAAGTCCTTCACAGATCCCAGGTTTTGGTCC
TAAAGACGAGACTTTTTTGATGGAACTCATTAAGAGAAGTAGTATTTTTTGTTTATTCAA
ACTGCAGTAACAGAATTTGTTACCATTGGTATGAGTGTCTTAATAGAGGAAATAAAGAAA
CTTTCATCTAAATCAAAAGTGCAGTCATTTTTGTGCTGCCCTTATTTTGAATACCATTTA
AAAAGAATTGACAACTATTTTTAAAGATTAAAGAAAGGCAGATGTCTGCAAATAATTCCC
CTCCATCAGCCCAGAAGTCTGTAGTACCTGGAACAATTCCTGCTGTGCTTCCAACTTCTC
CATGTTCAAGTCCTAAGACAGGATTCTCTGCCCGACTCTCTAATGGCAGCTTCAGCGCAC
CACCCCTCACCAACTCCAGAGGTTCTGTGCATACAGTTTCATTTCTACTGCAGATTGGCC
TCACACGGGAGAATGTTACCATTGAAGCCCAGGAGCTGTCCTTATCTGCTGTCAAGGATC
TTGTGTGCTCCATTGTTTATCAGAAGGTATTGTGCAAACTATTTATATCAATAGTTTTTC
TAATTAATAGTTTCTAATGCTTCTGTATAAATTATACATGTTAACAATGACTTAACACAT
GAATCCATTGGTAATTTTTGTCCCTAATTATGAGTGTGTTTAGAAGCATTTGAATAGATT
GTGGGCTGAAAGTCTGAAATTTCAGAATCTAATTGGAATCTCCAGTATATTCTAGACTGA
AAACATTCTTTATCCCAGCATTAAAATACCACTATTTGTCTTTTAAAAACTGAAGAATCT
GTAAAATCAAAGGGACATAAGAAATCTTAATTGTTTTTGGACAAAGTCAGAAGGTAGAAG
GATGTAAAAAGACACTGAGAGGGTACTTTACCAAAAAGCTGGAACACAGCAGTGACCACT
TCCACACATTGTGCTTCTAGGTGCTCTGTGTTTTGTCTTCTCTTTTAGATTTCCTTTCCA
TTTAGATTTGGATTACTCTTCTAGGGAGATACTCAGAGTCTACTTAAAATATCATGTTAA
TATGGGAGGACACACTTTCACCTTAAAAAATAGGTAAATCAGTTTTGAAAGTGTGACATA
ATATTTGAAAATTCAAAATGGTTTTATTTTGTTCCCCATTTTCTACCCTACATCATACCA
GTTTTTAAATAATTTAAGTTAAATGGCCTTAATTTTGACTAAAAGTGGATGAGGTAGTAT
GTTTTTTATTTACTGTGAACTATTTATATGGGTTATATGAATTGGTTTCCTTTTCATTAC
AGATTACAGAGATTCTTTTACAAGATTCTTTTGCAAATAGTTTCTACTTTAAAGATAATA
TTTAAACTTACAAGGTCTCACTATGTAGTGCAGTCTGGCCTTGACCTGACTTATGTAGCC
CAAACTGGACTCAAACTTACAGTGATCCTCCTCCTCAGCCTCCCAATTTTGGGGGTTATA
GGCATATGCCACCATACCTGGCTTACTTTTGTTTTTTAATTGACATGAACATTGTATTTA
TTGCATATAACAAGTTTCACAATGGTACCTATTGTATAATGGCTATATCGAGCTAGTTAA
CTTTGTCTGCTTATTACTTCACTAATTCACTTGTTATGTAGATGCATACTGATATTTCGC
ACAGACTGTAGAGTAGCTATATATTACTAGTGACTTGCTCAGTGATTTTATTCTCAAAAT
CCACAGTTGCTGATGTGTCAATCGAGTTCGAATGATTTCAGTATATAATTCTTGATGTGA
AATTTCCGAACCTTTAATTCTGAATTTGAACCCTCATGTTTTGCTAGAGGCAGGAAAATG
AAAAAGGAATTTCAAGAGGTAAATGACCTTTTCAGGTTCTAACTGGAAAGAAATCTAAAG
GGGACCGCTTAGATTTTGGGATTTTGCACAATGCCTTCATGAATCTAACTTATGTGGAAG
ATGGAAAAACTATGTCCGAAATTCTTTTCTTTTTACCTTCTCTCTTGTCTGAGACAGCTT
GCTCACTAGTTATCCATTTTCCTTACCTACACATGTACAATTCCAGATTAACTCCTAGGG
CTCTGAAATAATTAGTTGAGTGATATTTAGAAGTTATTTTGAATCTCTTCATAATTTTGA
TTTTACATGAAAGGGGAGTCATTTATAGAGATGATGATTTCCCTATCAATGAATGCTCCA
GATTTTTAAAATAGTAAAGACAGATTACATTAATAATAATAGCTAGCATATATGGAATGG
TTATTGTATACTTGATTCTGTTCTCACTACACATATTTCATTCCTTCTTCTCACTGTTTG
AGGTGAATATAGTCATATGTAAGGAAACTGAAGCACATAGGGATTAAGTAATTTTCCAAA
GTATTTAGCAGTAAGAATTCAGAGCTCATGTTTTAAATTGTGTTCCAGCTAACAATATTA
TCTTTCTATTATCAAGCATTGCACATCTATAAAATGTCTTCCAATTAAGTATACAGTATA
CTCAGTAACCACAGAATATAGTTCTTACGAAGCTAACTGTCTGCTATAACAAACTAAATT
AAATCGTTCTTCATAAGAATTGACATTTAAAATTCTAGAAGGTACGCCAGTACCTAACAT
TTTTATATATAATTTGATGGTTTGATCTCATGGATGTACCTGCTCTTTTATTTTTGTTCA
TTATAAACTTAATTATAAAGAATCTTCAAAACATGTAGCACTGAAAAAAAACCATATAGC
ACTGGTTAAGTCTTAGGCAGTAGATTAATCATGAAGTGACCCATTCTTAAAACTTTAGCA
GGGGAAACATCTTGATCAGCATAAAACATGATAATTAGCAAGCAAAATAAAAAATTTTTC
TCAGGTTGATGAATGTAGAAGGCTTCACACAGACAGCAACATTAAACCTCATACTTAAGC
ATGAACACGATTTCAGTCAATTGCAAGGTGAGAAATATATTCTAGGTAAAAGGAGCAGGG
ACGAGCAAAGATTTGGAAGGAGGAAAAGAGAATAGGATAACTGATAACATTTATTGACTA
CCTACTCTGTGCCAGGGAACTCTATAATATTCAATTTAATTTATACAACAGACTGTGTAA
ATCTCAGACTTTATTCATCTGGGAATTCTATAAACACTTTAAAATCAGTAGGTTTGTGTG
GGTATACATTTCTTGTATATTACCTGGTACTGTTGATGCTCCTTTCACCATAGACCCATA
CTGAATTGCAAGGGTGTGGGTGATCTCTGTTCAGTGAAAGGAGGAAATTGGAATTTAACA
TTTTTTAAAAATTTTATTTTGAAGGTAGTAAAATACAATAGAACAAGACAGAATAAAGCC
AGTCAAGACAGTGGACTGAAATTGGTCTAGAACTTTAGAGCAGGATACCCAGATAACAGT
AATAGGTACTGTAGTATATCTTGTTATCTTCACATGTTTATTCAATCAGGTATAGCAAAA
TCAAACCAAAAACAGAACATTATAGAACCTATCAAAACAGAGTATTGAATAGAGAAAAAA
TCAGAACAAAGCAAACAGTGAAAATAATATTTTCCTGCAAAGAGAAGATAGAAGGAAATG
CCCCATATTTGCTATATTGCTTACAGTCATCCTCCCAAGAGATGCTCAGACCTCTGACCC
CAGGACAGCATAATCAACCCACCAGTACAAGCATTTAGTTGCTTTACATGCCTTAGTTGC
TATCAACTCTGGCTGTCCTCGACACCATCCAGTTGCTTAAGGTAGGGGGGAAGCATGGGA
CGTTTGGTTCCCAGCCTGTGCACTGGTAAGCTCACGGGGGACACTGACTTGTCCTCTTCC
TGACGCACCTCCTGCTTGCTCTGGCTGCTGCTGCTTACCAGGAAGGAGGGCTTGTTACTT
TCTTGCTCAGCTCCCCAAGTTCCAACACGGCTGGATCTCGGGGGACATTGACTTGTTCTC
TCCCTGGCATGCCTGCTGCTTGCTTGGAAATTGGAATATTAGAGACTAAATTACATGCTA
AAAGTCAGATTTTACACAGGTAAATCAGCTTTTATACTGTTGGCTCTGTACCATATTGCC
TTCCTTATGGCAATGAAAAATTTCATACTTGATTTTTCTAAGAGTAAAGATTTAATTAAG
GTCTTTGTTACAGCAAAGTGAGATGGTCGTGTCTCCTTTCAGAAAGCTTAAATATGGAAG
CTGAGTGTGAGATGAAGTAGAAATACCAGGTAGGAGGCCATAATACTGATGACTTGAATT
GAGACATTTGGAGAATGAAGGCATATTTGAAGGTTGTCAAATAAATAATTTTGGTAATAC
TTGACATTCTATTAAACCTGCATATAATAAGGGAAGAGCAAAGGGTAAAAGATGACCAGT
TTGAATTGAAGTATGGCAATGCTGGTGACCAATGCAGAAAATCTAGAATGAAAAGTAAGG
TTTTTTTCTGGTGGAGATAACAGAATTTATTTTTATCAAACAATAAAATAGAATTCCTGT
GTTCTGAAGATTTTTAGGACAGTTAAAAGCGTGTTCTTCCATTACCATTTTGCACAGGAA
TACACACTGGGATTTTTTTTGCTGTCCTTGACTCTTAAAATATAGTCATTATTCAAGAAA
AAAAACCTCTCTCCCCAAAAGAATGACCATCCCAGCTCTTTTGTTAACAAAAAAGTTAAA
AGATGATGAAATGTTCTTGCAGTTTAGAGGACCTGAGAAGAGACCATTAAGAATGAAATA
AGCCCAAAGGCTCACCATACTTTTCATTTAGAGGAAGATGAGTACTTGAATGATAAATTC
AAATACAGTTTGTAAATTTGTAAGATTTGTTCAAGTACCATTTCAGTGATCCAAGTGAAA
ATTGTGAGATTGAAGTATTTTTTAGGTATCCCTTCCCCAGCTCTCCACCCAAAAGACCTT
TTTGGTGAGTATAATGATCCCCAATATATATAATAACAGAATAATGCAGACTTTATTATT
ATATGTATATAGACACAGAAATATATGCATGTATTACATATACAAAAATAATATTTAAAT
ATTTTTAAAACACCCCAGTGATCTAAAATGAATCACTATTATGCATGGCTATTAGATTTA
TAAATTATTTTATTGGATAAGATTAGGTTTTTATGTTGATTTATTTTCTGGTTCTTTACA
CGGGATTATGTCATGTATATAAATTTTGGGGTTTTCTCCCTTAAGTGCTAGTTATGTTAG
TTGTATTTTAAAATTCATATTTGAAATACAGCCTGCCTATTATAAAATCATACAGTTTAA
GTTCATGGGTCTGATGAGTTTTAACAATTTTATACAATGGGAGCTGGGGATTTAGCTCAG
CGGCATAAGTGCCTGCCTTGCAAGCAGGCAGTCATGAATTCGATCCCCGGTACTGATAAA
AAGGAAAAAGACAAAAAAAAAAAAAAAGAATAAAAAAATTTTATACAATGTACAGTTGTA
TGATCACTGATGATTCAAATTATAAAGCATTTCCTTTATCCTATAAATCTCTCTTGCACT
TTTGCAGTAGTCTCTATCTTTAGCCCTAAACAACTACAACTCTACATTCTTTCTGTATAG
TCTCTTTTGTGAATTTTCACATAAATGAGATCATGCTGTCTGTGGTCTTTTGTCTTTCAC
CCAGCACAGTACTTTTTTGGAATTTATTCATGTATTTCTGTTTCAGCAGTTCCTTTTTAA
TATTAAACTAGCTCATTTTATGAACTGACCACAGTTTGTTCACTTATTACTTGACCAACG
TTAGAGTTGTTTCTTATTTGGTCTGTTAAGAATAAAGTTTGTAAACAGTCCCTTATAAAT
CTCTTTTAAAATGTTTGCATTTCTCTAGGGTACTTAATATAATGGCTGGGTCATATGATC
AATCTATATTCATATGATACTAACATACTTTTCTAAAATAGGTATACCTTTTCCTTATGA
GCTCCACATTCTTGCCAACCCTTAGTTTTGTAAGTCTTTTTAATTTATGCGATATGGTTG
GAGTATAGTAATTCCTCTTTCTAATTTTGATTTGCATTTCTTTAATGATTAAAATACATG
TTTTCATGGACTTTTCATTCATGTTTTCTCTGGGGAAGTCTATAAATTGTCTTATTGAGT
GTAAAAGTTGTCCATATCTTTTTTGATTACTGTATATTGACAAATTGTAATCATATACAC
TTACCTAGCACAAAGTACTGTTGATTTGTAATACAATGTGGAACAATTATATCAAGCTAA
TGGTATCCAGCTATCAGATATGTTTTTATGATAAACATATTTAAATTTCTAGCAGTTGTG
AAATATACAGTATGTAGTTGTTAGCAATATTTATATATAGTTACATTTTGCAGTAGAACT
AAAAAAAATTGAACTTGCTCCTTTTGTCTAATGAAGCTTTGTATGTTTTGTCTGTCATCT
TCTCCCATTTTCTCTATCCCCCAGCATATGGTACCCAACCACCCACTGATTTTACTCTCT
GCCTCACTTGCTTTAGATTATACGTACAAGTGAAAATATGTAGTATTTTTCTGTTTGGCT
TATTTTACTTAGCATAATGTCCTCCAATTTTAATGTTACAAATGACAGACTATGTTCCTT
TTGTAAGACTGAATAGTATTCCATGTGCATTTGTGTGCACCCCATTTGCTTTCTTTATTC
AAAAAAGCACTTAGATAATCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTCCTACGTGTCAGAAGGGGCTGGTGTCTGGTTTTCCTCCCCACAGCCCACACAATGG
TGCCAACTCACAGGAAGTGACTGGCTTCTTGTTCTCCCTGTGGCCTGTGAATGGCCCCAG
ACTTGTTTTTTATAACTTGGCCACAGTGTTTTCTGATTTTCAGTGGCAATATTTGATCTT
TTCATGATTTTATTTTTTATTTAAAGAAAAAAACAGTAGAAAAAAAGGTAGGGTAACACA
GAATTCAAAAAAATTAACACTAAGAAATCTCTAGTTGATACGTTACACATTGTCATCTTA
GAATTGGTTGTTCAAATTACAAAATCAAAGCATAAAAAGTGGATAGACACACACTGATAG
TGTAAACCATTCTGTTCATTGATTCAACAAAAATATAGTCATCTGGTCATCTATCTTACA
CACTTAAGACATACAATTATATCCTTTACAGCAGTTTCCTTCCCTTTCATTTTTACAATA
TCTATTATATATTTTGAATCTTATCACTCTTCTTTTTTTTTAAAGGCCATTGTTTTCTGT
TACTTCATTTAGGTCTTCTGTTAGGTCATAACTTCTGTTAGTTCATTTAGACTCTTGCTT
TCAGATAATTCCTGAGTATCTTATCAAACACACCCATCAGTTAAAAATCTGTCATAAGCT
AGTTACAGCTTTTCTCCTCAGAACTCTGTAATCTGTCAGTTTAATAGATAAATATAATTA
CAAAAACATTTGCTAACCTAGAAAATGACTTTATTTTTACCATCACCAAGGGCTTTTCAG
CCTCTGATACACAAGTGTTCATTTTAATATGTATACTTGTAAGTTTTCCTTTTGGTTTAA
TATGTATACTTGTAATTTTGCCTTTTAAGTTTTTTATTCTATTGATACTGATTTCATGTT
ATTATTCACCATTATGAGTCTTATGAAGATCATTTTACAGTAAGCTGTAAATGTATTACG
TTAATGCTATTTTCTTTCTGTCATTGTTATGTTTATTATTAAGTTCTTCTGTAATAATTA
CTTGGATATCAGGCTTATGTATTAATGACCCATATGATTTACCAGAAGAACTGTTGTCTC
TTCATTTCTCATTATATGATTTAAACCCTGTAACTTCTTTCCTGACTTATAGCTTCAGGA
GCATACACTGATCTTTTCCTGTCTCAGTTCCTGTACACAGTACTATCAGCCTAATCTTTT
TGCACTAACATTTAATTATGTTATTCCCTTGCTTAGAATATAGCAGGATATTTCCTTCAA
TATAGCAAAATAATGTAAACCAATAGCGTTTATTGATCATAAGGCTCAGGATTATGCAGT
CATCAAGAAATCTAATTTTGATAAATACCCATTTTATAAACAAGAAAGTGTTGTGAAAAG
TAATACAACACTTAATCTTAAATTAATCTGAGATGTTGTAAATAGTAGATACCAAAACTT
GAATCAGCTGTGTTGACTCCAGCTTTGTTAGTATGGCTCTAGTCAGGCCCCATGTACCCC
CTTTGTGCCCCTTTGGTACTACCCAGTTCTTCTGCACCTTGTTTAAGTCACAAGTCTATA
CTCAACTTTGTTCTCAGTATTGACACATATTTATTTTCAGCCTATGGAAACCCTGCTTCT
CCCCCCACCTTTCTTCTCCCTCCCCTAATTCTGAGGATTGAATTGAACCCAGAAACTCAC
ACATACAAGGCAAGTGCACTACTGTGGAGCAAGAACCCTTTTAAAAACTGTGAAGCCAGT
ACCTTGTATCTAGCAGACATGCAAGAAATATAACTTAGAAAAACCAATTTCATTCATACA
AAATTTGTTAGATTTTTTTATAAAAATGGATTGTGGAATCTGTTGTTACTAAGAACTGTT
GCAATTTAAGATACTTCTTTTTCCAATTAACTAAATTTTGTAAAATCATATTAAAATGTA
AATAAAACTTCAATGTATAATTTAAACTTTTGTATGTTTTTTCAGTTGGTTCTTTAGAGA
GATGGGAAAGATTTTTCTAATGAAAAAATGAAACTTGGAAAGTAAAAGGAAGCTAGGTTA
CTTTCTGTACCTAAAATACCTGCCATAAGATCATAGACTGATGCTAAAAGTGGGGTATAA
ATTTAGGTGTTTATTTCCATTGGGCAAAGTAAACAAGAAAACATGATTTAACTACATGAT
GAAGTTGTTCATGTTACAAAACCAGTCAAAGAAAATTTTTCCACGGATCTTCACAAAGCA
GGACTACCATGTGAAATAGATAAATCACATTTCAACACCATTGCTACCATAAATAAATAC
ATTTATAGTTTAATGTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGGCTCGTTTTTTTAAAATTGGCTGGAAAATCAAGCATGATTATTT
TGTAAGGCAAATATTTTAAAATTTTCTCTTAACCTGAAACAATTTACTTTGTATAGTAAA
TATTTATCTTCATATTTTAGTCTGCGTACTAATCCCCAAAGTCTCTTGGCTCACAAAAGT
CAATGTAGAAGCCTTGAAATAATACAAATGAATAGGCCATATGTGAACAAATCTGCAAAT
CTCCTGCTCTGTTTAAAGATTTTTCTAAAGGGTAATATAATGAACCATGTGTTTGAAATT
ACAGTGGTAGACTTTAGAAAGATACTAGATAAACACTAGACCAGTGGTAGTGCATGCTGC
AGCAGGCTCTTTGTTATTGAAAACTCTAAAAGATTCATCCTCACTGTTTTAGAATATTGT
AGGAACATTGCAAGGTACTCTTGTGACTGGAGTTTGAAAATTACTGGCCTTCTATCTAGC
ACAGTTCAAACTTAGCAGAATAGTAGAGTGTTCTGCACCATCTGGTTCTGTAACTTGTAG
TCAAAGTAGCAGCTGGGCACATGTAATGTTGCTGAAGTGACCGAAGAACTGAACTTTTAA
TTTTGTTTATTTCATATTTAACTTCATATGATTAGTAACTGTGTAAATCAACTTCCTGTT
GCTGTAACAAATACCTTACACAATCAACGTAGAAAAGGTTTATTTTGGCTCTGTTTTAGA
GATTGCAGTCCATGATTAGTTAGTTCTCTTGCTTTTGGCATGATAGTAAATTTACAGGAA
GAGCATATAGCAGAGCAAAACTGAACACCTCATGGTCAGGGAGCAAGAGAGCGAAAAAGA
GACGAAGTACCAAAATCCCTTTTCAAGGACATACCCCCAGTGACCTTAGAGCCCCACTCC
CAACTGCTCTAGCACAACCTCCCAGTAGCACCCCGATGACCGATGACCAAGCCTTAACTA
TCTGGAACGTTGGGGAACCCTTCAGATCCCAAATGATAACCATTAGATCAGCTCTAGAGA
ATGGGATAAAGATTTGTTGTCTAAAAATAGCTAGATGTAGTGGCACATGCCCATAATTCC
AGCTCTTGAGAGACAGAAGCAGAAATACTATAAATTTGAGCCCAGTCTGGGCAATTCAGT
GACATCATTAAACCCCATCCCCAACAGCAATGTAGTTCAGTGCGAAGATCCTTGCTTCAA
TTCCTGGTACTAACAGGGAAGGAAGGAAGGAAAGAAGGAAGGAAGGAAAAAGGAAAGAAC
AATAGTAGTAAGTTCAAGATTATATTCACCAACTGTTTGGAAAGCCTATATTTGTAAGAG
ACTTATATTTCAATATAATTATTTGTAAATTTACTTTTCTGTATCTGAACTTTAAAATTA
GGGTGCTCAAGTATACGAATCACCTGTAGATACAGTACTAATGTAGGTAGCTAAAACACT
ATTTACAATTCTTTCAGAACACTGAAGTATAACATAAAAATGGAAAAAACTATGGGTATA
TTGACATAGGACCATTTTCCCCCAGTTTCCAGAGTGTGGATTCTTTGGCATGTATGACAA
AATTCTTCTCTTTCGCCATGACATGAACTCCGAAAATATTTTGCAGCTGATTACTTCAGC
AGATGAAATACATGAAGGAGATCTAGTAGAAGTTGTTCTGTCAGGTGAGTGAACACCTCC
TTTTATTTTTTTTTCAGTCATTTTCTGTACTAAGTGCTGTGTTCTATTACACTTAATCTT
GATACTATACAGTTGCCTCCTCTCTCATTATGTTACTGTGTGGTTTTTGTTTTATTTTCT
CAACTTCCAGAAAGGTTATACCACAGATGGGAAAGTAGGAAAATGAAGTGACTTACTTGA
GCTAAAAAAATTGGTAACTGACCTGAAAGAGAAATGAAACAGTAAAGGATACCGTTGAGA
AGAATTGAGATTCAGGAAAGAAAATCAGGAAAAGTGAAATAATATTGAGCATATAGAAGA
GGAAGTGACAATATTTGTTTTTTGCGTGTCTTAAAAAAATTCTTCCCTTTTTGTTTTCAA
TGGACTTTCTCCTTTTCCTACTTTACACATTCTTGTCATTCCTTCTTCCTTAACTCTCAC
TGTTTCCATTATTAGTCAACATCATGACTGCTGTTTGTGGGCAGGATTGTTTGTGAAGAG
TGTAAAGAGGAGAGAAAGCTATAATGATGTACGCAGTAGTCTGCAAGGCTGTTTTTTGTT
TTGTTTTGTTCTGTTTTTTTGCAGGAAAGGAGAATTGTTGGGAAAATGGAAACAAGCCGG
CTAGCCAAGCTTTCAGAGTCTTGCTGCCACTTTTCCCTCCTCTAGTACTCGCCTTGTTCT
TGAGATTCTCTTAAAGTCCCTGTTCATTTTGCACTTCTAATCTTGCTTATCTAGCTTTCA
GCATGATCACTCATCTTCTGCACCACAACCACAAACCATCTGTAACCTCGGTACATCTAT
TCGCATTCTTTGTCTTCCTCTTCATTCATGAAGGACTTCACTCCCTGTCCTCCCTCATGC
TCCCGCTCCTCGTGCTCATACCCATCCGTTCTTTGCTATGGATCTTTCATCAAATCACAG
GGACAAGCCTAATGACTTGCAGGCTGATATGGGAGGGAGATCCTTGTGACCTGTTGCTTT
TTTAAGAGAGAACTCTTTCTCTTAACCACTAGGACTATGGAGAACAGAGAGAACAATCTG
AGTCTGCCGGGGATCTAGTCCAGCAGCATAAGTCTGCTTCGCAAGTGCAAGGTCCTGAGT
TCAATCTCTGGTACAAAAAAAGTAATAATCTGGGTCCAGGGTGGGATCCTAAATAAGAGC
TCAGTATCTTTTTCCCACAGAAGTATTACAATAAATTAAAATTAGGTTCCACGGATTGGA
TTGTTTTTGTTTTGTTGGGACAGGAACCTTGCTTTTTTTTTTGGTGCCGGGCATTGAACT
CACGACCTCATGTTTGCCAAGCAGGCACTTACGGCACTGAGCTAAATCCCTGGCCTTGAC
CTTGCATTTTTACCCCTACTGTTTTTTCATTTTTTTACTTTAGTGTTCTGTTTCTCAGTT
GTGATAAACGTTAGAGCAGGTGTTTTTGTTTTTAAACAAAAACAGCAGGTCCCACAACAT
AGCCTGGGCTGGTCTTGAACGTCATCACTTTTCTCAGCCTCCTGAGTGCTGGCATTACAG
GCATGTACCACAGTGCCAGCACTAAATAGTTTTTAATTAGCTAAAATAAAGCTAGTGGCA
ATTTGTAGTCTCATCACTCTAAGAAAGGACTTTTTTGGAGGTCCAAATGCCTAACTTATA
GGCCTCCAAGTTAAGTTGGAGCTCAACTTACTTGAAGCTAGTGAACTTTCTAGAGGTTAA
AAATCACTTTTTTTAAAATCATAGTATTAAATCCCCAAAATAGTTTGTTTTTATGGTCAG
ATGAAACCTTTAGGGAAAAAATTATTCTGTGTTTTGATGAAAATGATGAACATTCCTACT
CTCTTTGCAATTACAAATAGAAAGTTTAATGCTTTTCTTTTTTAAAAGCTTTGGCCACAG
TAGAAGATTTCCAGATTCGTCCCCATACTCTATATGTACATTCTTACAAAGCTCCTACTT
TCTGTGATTATTGTGGTGAGATGCTCTGGGGATTGGTACGTCAAGGGCTAAAATGTGAAG
GTATGTATTACATTTTTGTCATTTTAAAAACGATGTCACATTTCTATTTTTATTACCCAT
GAAAAACCAAGATCATAAATGTTGAGGTAGTAAAACAAGTTTACAATTACAGGAGATTAG
CAGATATTAGGGAATTTGGGACCTATCTCTGTCATCTACTTGTTCCTGTCTTTAAGCAGG
TCCTCTTTGAGGAATTGATTTCTCTGTATATATATCCTACCTAATGAGTTTCATAAAAAG
TTAAATTTAAGGTAAATAGATACATTTGATACAGAGTAGTGGGTCAACAAAAACCAAGCT
CCTTACTTACCATAAGAACTTTTTAGAAAGTTGACCAGCTTCCTTCTTTATCATCTTTTT
AGAAAGTTAAATCTCTTGTGTACAAAACAAAATTGTCAAAGATTTTCTGAATTAGGATTG
CTGGGAGTAGGGTATAGGTATACATTTTGACCAAGGAACAGTATTCTAATATGGAGAGTC
AGAGAATAAATATTTTAAAATTCACAGACCATATGGTTTCCATTGTGACTTAACTCTGTT
ACTATAATGTGAGACTAACCATAGACAATATGTAAGCAAATGGCATGGCTGTTATCTAGT
AAAATATGTATTTATATATACTGAAATTCAAGTTTCCAATAATTTATCATTATGGGAAGG
TTTCATACATAGGACACTGTTTGTTGCTGATCAATGCTTTAAGCCAGTGGTTCTCAAAAT
TTGCCAAGCATCAGAAAACATGCTTCGCTGGGCTCCATTCCCAGACTTACTAATTCAGTA
GATCAAGGGTAGAGCCCAATAATTTACATTTCTTACAGATTTCCAAGTAATTATTTTAGG
GACTGCAAAATCCACTACTCCAGCTAACTTAGTCTTTCTAAATATACCTTTCTCTGTACT
ATTCTTGTTTAATTTATAAGGTTTCACTCAAGTATTGTCTGGGTTCTTATTTAAGATGGT
GTTGTTACCAGAGAAAATAAATAAAAGAAGCACTAGTTTTTATGTTGTACACTTAAACAG
TAAAGTTTTTTTAATCTTACATTTTACCTTGTAAAATATTAGGCTGTGGATTAAATTATC
ATAAAAGATGTGCCTTCAAGATTCCAAATAACTGTAGTGGAGTAAGAAAGAGACGTCTGT
CAAATGTATCTCTACCAGGACCTGGCCTCTCAGTTCCAAGACCCCTCCAGCCTGAATGTG
TACCCCTTCTTAGTGAAGAGGTATGTATTCTAAGGTTATAGAAGGATATTTTACTAGTTA
TTCCTAGTGCTTCTGTAAGATACAGAAGAGCATGTGTTTACCAGTTTTCTAGGAAGCTCA
CAATTTAGTCACGTGACAAGCAAGATTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTCTCATTATTATTCTGTGATTTTACCTCTAATGTATGTGCCTTTGAAGGGTA
AATAATATAGATCAGAAAAGAGAACATACATCTCATAATGCCTGAAATGACTTCTCCCTA
GATTGTAATGTTATCACTTAATTGTTTCTATAAACTTCTCAATCTTTTATAAATTCTGTG
GCAAAATGAAGGTGTTGTACTATTGTCTTGACAGCCTGGTTACAAGATTTTGCTACCCTG
ATATACCAAAGTAAAAACCTCTGAAATCCTGTCATAAAAATCCTTTAGTTACATATTACT
TAGCTGTAATGTATGATTTCTAAAATAGAAAAAGAATAGTGGGCATAAGTACTAAGAATG
AATGGTTATATAATTAGTGCATTTTATACAACCAAACTGCACAAGAAACTTATCTGGGGA
TGAACAATATAGGGTAATGGTATGTTTTAAAAGCCCAAGAAGACCATATTTAGAGTTGAT
CAAGTACAATAAAGTAGCAGGATACAAAATCAACATTAAAAAGTCAGTGACATTTTTATC
TAGCAGTAATGAACTACTAAGAAAGAAACCATAAGAACAAGTCACAGTAGCTTCAAAAAA
AACCGAATCTTAGGGACCAGCCTAACAAAGGAGGTAAAAGAAGTCTACAATGAACATTAC
AGCACACTAAAGAAAGATAATGAGGATAACACTAGAAGATAATGAGGATGACACTAGAAG
ATGAATAGACCTCCCATGTTCATGGGTTGGGAGGCTTAATATTGTTAAAATATCCATATT
ACCAAAAACAATCTACAGATTTAATGAAATTGTCATCAAAATTTCAATGACATTCTTCGC
AGAACAAGACAAAAAGTTCCTAAAATTCACATAGAAACACCAAATACCCAAAATAATCAA
AGCAGTCTTAAGCCAAGAAAGTTCACTCCTGAGGGCACAAAAAGGACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAATGAATCTCATTATCTTCACAGCTGATGCCTAAATTTTC
GAACCTGATACTATCCAGCAAAACAGAATAGGGGAACATCAGTTAAAAACCAGATGGTGA
GAGTAATACAGGGCTTTAAATCGAGGTAATGGAAAGTCAAAGTGGGTTACTATAATATAT
CCTGCTATTTTTTTCCTTTAATTAAAAGGATAAAAATTTTTTTAAAAGTATTAAAAAAGT
AAATAATGGAGTGGAGATTGAGATAAAAGAGGGCATAACAACGAAACAGCACAGATCAAA
ACATAACCATTTAAGCAGAATAGTGTTTCACCACCAGATAATCCTGACATAAAAGTAGTT
ACCATATTGTCTCTTTCCTTGAAATCCTTGAGTACAACTTCGTATACTGTAGCATTAAGT
ATATCAAAACAATGTAAAACCATTTAAGAGAATGACAGCATTACAGAGTATTTAGAATTG
ACTAACAGAAAATGAATAATGGATTCTGTATAATCTCCTTGTCTTTAAAAGGTTTTTGCT
TATACTATCGTACATAATAAAATCCAGTAAGATACAACCTATTTAGACCATTGGAGACAG
AAGAACAAAAGCTAGATGAGACTTCACAACAAGATGATACTAAATCAGTATTACCTATTA
AGATGTCATTTTCTCCAAAATAGCTTTTCCTATCATCCAATCTTCTCTGTCTCATTTCTG
TTGAGCTCTTATTCTGTCAGTAGCTGTCAGTTTGTCTTCTTCACTTTGTTCTCTGCTCCA
TTAGTTGTGGCCTCCACTATTTCTGGATTCTTTGTATTTTTCTTTTTTTAGAATATCTTG
CAATACTCTCTGTAGAGTTGAATTGGTGGTTGCAAATTCCCCCAGTTCCTCTTTATCCTG
GAAGCACCTTGTTTTTCCATCAATTTCCAGGGACAGTTGTGCAGGATATCTCAATCTTGG
CTGGAGATTATTATCTTTCAAAGCTTGAATTATTTCCCCCCACGCTCTTCGTGATTTGAT
GGTTTGTGCAGAGAAATCTGCTGTAATTCTGATGGGTACTCCCTTGTAAGTGGTCTGTTT
CTTGTCTCTGACAGCTTTTAATATTCTGTTCTTGTATTGAATTTCTGGAATTTTTATTAT
TATATACCTGGGTGTTGCTCTGTTTGGGTTGTAGGTAGCTGGGGTCCTGTATGCCTCATA
CATCTGAGTATCTTTACCTTTTGCTAAATTAGGAAAATTCTCCTGGATTATTTCTGTGAG
TAGCTTTTGTAGTTCATTTGTTTGTGTCCCTACTTCTTCTTTTATGTTCTTAATCCTTAA
GTTATGGATCCTCTTATCATCTTCTTGTCTTTGTATTATTGCTGTTTGTTTCTTTGTTAT
TTTTAAGAAGTTTTTCATTTCATTCTCCCATATTATAATTCTGCCCTCCAGTTCAGATAG
TCTGTCCTTAGTTTCTTTCAAGCTGTTATGCCAGTCTTCGATAGACTTCTTAGTATCTTG
GTAGTCCCTTTGAACCTGCTTCACGTATTCTATGCTTTCCCTGTTTTCTCCATCAAACAA
TTCTCCCCTCTTTTTCTGTTCTTCCATTCCACCATCTGTTTTTTCTTGGGTGGTGCTTAG
CATTTCTCTAACTATTTTGCATACTTCTAGCTTCAGGTCGTTGATAACTTCATTCCTGAA
TTGGTCTATGAGGCTCTCTATATGGCGCTCTATGTCTATTGATGCGGTGTCTGCTATTGC
TGTTCTCAGAATGGGGCGAGAGCTTCTTGTGCTGCTCTTCCATATCTCTGTCTATATATG
CAGCTACATAGAGCCCACTCTCTCCTGTCAGCACAGCTGCTCGAATGCGCAGTTAGTGTC
CCACCACACAGCACACCAGGAGTCCAGACCAGCAGCTACGCGGGCCTGCCCTTCCCAGCC
ACGTCAGCTCTGGGATCTGGGTTGGGCTAGCCTACTGGGTCCGCCAGCAGTGTCACGTAA
GCTAGGCACTTTTCACCAATCCCGCCTGAGAGGGGGATGTGTGGCTGAAGTCGCCACCGC
GCCCTGCTCCCGCAGGACTGCCTGGGCCCAGAATGTCCTCCGCTGGAGTCAAACTGTGGT
AGAGTGTCAGTTTCTCTCACTCACCTCACCACAAGTCAGTGCACACCTCCCTGCCCGTCC
TGTTTTCGACTCCATTCGCAGATTCCCGTTCTCAGAGCTTCCACCCCCGTCTCTCTCCTT
GCCAAGCTGATGTAGAGGCAGCCGCCGTGCGGCAGGAAACCCAAATCGCGGCTTCCAATG
GCGCGGGCTCCAGCCTCCACACTGAGGCTTTTCTGTTCCTGTTTTAGCACCAGGACTACA
TTCCAAGTTGGTTTCTCTCAGCCCAGTTCGTTCCTGAGTCAGCAGAGCATATCTCCACCC
GCTTATGTCTCCTTACTCCGCACCCTTCCTGACTTCTGAGCCGAGTCTTTCAGAGAGCCT
CTGTAGTAGCTGTTATCTGTCCGCCATGTTCTCCCAGAAGTCGCCAAGTGGTGGTTGTGA
TTGTTTAACGTTCTGTAGGCCTCACTTATCTGCATACCAGATTTTTCCCCATGTTTGGGG
AATTTTCTGCTGTTACTTCTGTGAATAGTTTACCTATGTCATTTGCATTGACTCCTGCAT
CTTCATTGATGCCTATTTGTCTCATATTTTTTCTCTTGGCATCATCGTGGAGCTGCTGGA
TTGTCATTTCATGCTGCTTTGTTATTTTTAAAAGTTCGGTCCTTTCATGATCGCTAATTG
CGATCCTGTCCTAAAGGTCTGAAATTCTATCCTCGGCTTCATTTAAATGATTTTGCCAGC
TTTCAATAGAATGTTTTGTTTCTTGGATGTCTCTGAGTTTGTTTCATGAATTCTGTTTGT
TTTCTGTATTGTTCATTCAAGGTTTCAATCAGTTTCCTATGCTCTTGTACTTTTAATCTA
TTTCTTCTCTAGCTACACTGAGCAACTCCTTTATTAAGGTTGTCATTTCTGTTTTTACAT
GAGAGATTACTTCTAATTTGATTTCCTCTATAGCCTCATGGAGTTGTTTTTTATTTCACT
TGCTATCTTTTCAGAGATTCCGGTGTGTTACTTTTGAAGTCCTCTATTTCCATGTCTCCT
ATGCTTGCTCCTGGTGGACTAGATCTTTGCGGTTGCATTTTGCTTTTTCATTTTGCCACT
TTTCCCTTTCCGGTTAATATTTGGTCGTCTAATCCCCAATGTCAACTGTTGATAGTGTGT
ATCGTGGGGTCCTACTCTAAGGCTGATGTTTGTACAATTGCTTGGTTTCACAATGAAGAT
GTGAGCCCATCACCTGAATTCCCCCTGCAAGGCCTAGGGGTACTAATGGATATCAACCCC
TAGTTCCTGCTGTTTTATGTCCTCAGGTTGTTCAGAGTCATCAGATCTCCCTATTCATAG
TATTTGTCTCGTCTAGGACCCTACTGTGTCTCTGGGTGTCCCACTGGCCCCCTTAAGTTT
CTCCTGGTTGAGGGAGGCCTTGTTGGTGCCCTCTTCAACTTAACTAATATTCTTTATATG
GAGGAAGTTCTCATTCACCCATTTGCCAGGCTCCCCTATGGCCTACTTCTGGAGGGGGCT
TCTCTGTTGCTCCTGTTTACCCACTGAAGGTGGCAAACTCTATTCCTGTTTTAGGGGCAG
ACTCAACTCACTGATGGAAGCCTGCTGAGTTCTTCTTACTGAGTCTCCTCTCGATACTGC
ATGGTTAATCCACTGCAGTGCAAGGTTCTTGGGGGAGTTGTGGGAGCCGAAGGTCAACAG
CAATACTAGGTCCAGGTGGTGGTGGGGGTCCCTGATGGCAGCGACAGGACTTTGTGGGAG
CACATCTTAGGTTGGAGTTCATAGGTCCTGAGGTGGGTGGCCAGGAATGTGGGACACAGG
AGGGGTCAGCTTGTGGCCCAGCCCCATGCGCAACTCTAGCTGTAGTTCCTGGTTCCAGCG
AGGTGGACTATGGAGACTGCAGGAGTTGCAGGTGAGGCCCCTGTCTAGGTGGTCTGCGGA
GGTGGTGGGAGTCTCAGGAAGGGCCTGGGTCTAGCCCAGCTCCATGCACACCTCTGGCTG
GAGTTCCTGGGTCCTGTGACATTGTCAGAATTTTTAAGTAAACTCTTCTACTGGATTATT
CATCTACCTTTTTAGAATTTTAAGAGAATAAAGTTTTATACTTATATGGGTCCAGAAAAT
GGCAGGTTATATTTTTTGATAGTTAAACTTTTGAAGTGAACAATAAAAATAAATTACAAA
CAATTTCTAAGATGACAATATGTAATCTATTAACTAGTGATTTCTTACTATTTATCTGAA
ATTCTGTATTACTTGTACCCTTTTACTGTTTTGTTTCTTCTCTTTAAATAAAAATTTAAA
AAAATAAATTACATTAATGATTCTTTTGTTTTTATAATATGCATTCAAATACTTGAAAAG
TGAAATACTCATCATTTTCATGCATCTGTTAAGCTAAAATTTGTAATTTAAGATAGATAC
ACTGGATTAAAAACAGTTCTTCACTCATTTATTCCTTCATCCATTTTTTTAATCTCTTTT
GCTGAATAAAAACCTTAAGGCATCTTAAAATCATATGTGAAATACAATAAAACATAAATA
AATTACTAAAAATATGGGTCAAGAGCACAGAGAAATCAAAACTCGGTGCCGTTAGAATCT
TGTGGCAGAAACTTAATGTGGTTAAATGTTGCACCTGTGGTACTGCTCTTTTGATATGTC
TTGTTGTTGTGTGTGTATGTTGTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTAGCTCAG
TGATGTAAATGCCTACTTGGCAAACATGAGGTCATGAGTTCGATCCCCAGCACCAAAAAA
AAAAAAAAAAGGAAACCTATATACTTGAGCCAGATATGACACAAATTTGACTCCAAATTT
TCAAAGGGAAAAAGAAACCTTCTTAATTTTCAAGATTTTCAGAGTTCATGGATAAAACCA
AATCTGTTGTTTAAGAGCTGTGCAAGATATTAATATCATATACAGTTTTTTTCCTAGGAC
CTCTCATAAGGACCATGTTACGTATAATGGGATTATTATTTGCCAAATTGTAATGATCTT
TAGCCTATGGTGGTAGCACTATGTAAGAATTCCTTGATTCACAAGAGTTACAAAGCATTC
CAAATCAAGAGTCAAAATGTTTTAGCCAGTTATTTCAGATCTGGTATTATAGTTACATTA
GTGGGTTTCAATTTTAATGTTACTTAAAGAGCTCATTGAAACACATGTTTGTCAGCCCTA
TTCTTTGAGTTACCAAGGTCTGGCTTGGGACCTAGGATTTGTATTTCTACTGAAGAGATT
TTATATAACCTTGATTTGCAGTGCTGTGAATTCTGAGGTTCTTATAGGCTGAAGAGAAAT
GAGAGACCTTGTGCCTATGAAACTGAATCCTTTCATGTATGTGAAAGCCCTTATTAGGTT
CCCCTTAACTGTTGAATCTGTCTCCTTTCAGTATATGCAGTAAGCATTAATACTTAGAAA
ATAAAAATAATATACTTGACATATATTGGATTGAAATAAGATGGCTATGAGATGAGAGAA
ATGCAAAACCAGCAAGTATTCTACAAATCGTATTAGGCTCATTATACTGTTGAAGAAACT
AATGTAGAGTTAAGCGACTTGTGGTAGGGTAAACAACTGCTAACGTGTGCCATCAGAAGT
TGAAACTTAAAACTTGAGTTCCTCTGAACACAGTGGTACACGCCTATAATCCCAGCATTT
GGGATTGATCTGCTGAGGCAGGAAGATCACTGTGAGTTCAAAGCTTCCTAGACTACATAG
CAAGACTCCATCTCAAAAAAAAAAAAAAAAAAAAAAACCAGAAGACTTTGGGTTCCTGGG
TGAGAATAACTGTTTTTTTAGCAGCAACATAATCATTACTAATAATAAGTTCCTTTTGTG
GTTTAAAAAAGTCTGGTTGAATCTGATTTTGCCTATCTCTGTATAACAATAAATTGATAA
TATTATTTTAGATTGCAAATTCAATTGCCATAAACGGTGTGCATCAAAAGTACCACGAGA
CTGCCTTGGGGAGGTTTCTTTCAATGGAGGTACAGTTATTTCTCTTAATTTCTATAAAAG
ATCAGAAAAGGTTGATTCTTTCATGTAAGATTATATTTGTATTTTTTGTTTCTTTAAGCT
TTTCATCTTAATAAGCAAAATACAGCAATACTATACCTTTATTAATAATTAAGTTTTATT
ATCTTTCCTTAACCCTCCTGTCACTTGATAATCTGAGATAGCCCATGCTACTATGTATCT
TCTGTCGAGACAAAAAAAAAGCTTATGTTCTAAAACTTTGTTGTTTTCTTTATTCTTTTA
AATTTCTAAATATTTATTGAATGTTTACTGTGCTAGCATTGTTCTAAACTCTAAAAACAT
GGACATTTAAACATAAGAACCACGCTTTTAGATAAGAAAAGGAAGCACAGACCTGCTAAC
ACATTTTTTCAGTGTTGTATAAATGATATTAGCCTCAGTACACAGATGAAGAAATTGATC
CCTGTTAGGTTAAGTGGCTTATGAGAAGTAACCCTAAGGAAGTGCTCTTCTGAGCATATG
CTTACTGGTTAGTTTGGAGATTTTGTCCTTGTTAGTTATGTATTTAAGTGCTTATTTTTG
TTTATTACAGATTAGCACTAATTTTATATCCTACTCTTTTTTCAGTTATATGTGGTATAA
AATTAAGCATCATTTTACATTCCCACCAGCAGTATACAAGGATTTCAGTTTCCCTATTTT
CTTGCCACCTGTTTTTACTTTCTGTCTTTTTTGTTACAGCCATTTAAAAGTGTGGCATGT
ATATTATTGTAGTTTTTATTGCACTTCCCTGCTGGCTACTGATATTGAGCATCTTTTCAT
GTGTTTATTTGGCCATTTTTATTTATTCTTTGGAAAATACCTCTTCAGGTCCTTTCCCAT
TATTAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAGATTAGCA
CTAATTTTATATCCTACTCTTTTTTCACGTTAGTATGTGGTATAAAATTAAGCATCATTT
TACATTCCCACCAGCAGTATACAAGGATTTCAGTTTCCCTATTTTCTTGCCACCTGTTTT
TACTTTCTGTCTTTTTTGTTACAGCCATTTAAAAGTGTGGCATGTATATTATTGTAGTTT
TTATTGCACTTCCCTGCTGGCTACTGATATTGAGCATCTTTTCATGTGTTTATTTGGCCA
TTTTTATTTATTCTTTGGAAAATACCTCTTCAGGTCCTTTTCCCATTTATTAAGATATTT
CTCTTTTTGTTACAAGTTGTAAAAGTTCTTCAAATAGTCTGGATGTAAGACTGTCATCTC
ATAATGCAATTCACAAATACTGTCTTCAAGTCAGTGGCAGTCTTTTCACTTTATTAATTT
TCCTTTTGTCACGTAGCCTTTTGGTGTTGTATCAAAAAAGGTGTTTCCTAACCCAGGATC
ATGAAAGTTTATTCCTGTTTTTCTTTTAAGAGTTTTATAATTTTAGTTCTCACATCTTAG
GTTGCAGTCTACTTTGAGTTACTTTTTGAATAGTTTAAGAAAAGGATCATACCTCATACT
TTTGCATGTAGATATCTAGTTGTCCAAAACCATTTATTAAAAACATTATACTTCCCCCAC
ATGAGTTGATCATAATGTAATAGTGGAGGCTTATCTTTTACTTTACTGGTATGTAGTACC
TGTTGTTGTATGGGAATTTAAAGTTTTTATGTCAAATTAATTTTTTCCTTATGATTTGTA
CTTTTGTGCCTCATGACTTGTGCATTTTGTATATTCTCTAAGAAATACTTTTTTATCTTG
AATTACTGTCTGTTTAAAAATTTTGACATTTTTATCTATTTAATAGACTGCTATACTTAC
ATGTGTTGCTATTTCATTCGTATAAAATCTGAAATTTAAAACCTTTCTAGAACCTTCCAG
TATGGGAACAGATACAGATATACCAATGGATATTGATAGTAACGACATGAACACTGATGG
TAATCGGAGTTTAGATGACACAGAAGAGCCGTCTCCTCCAGAAGATAAAATGTTCTTCCT
GGATCCCTCTGATCTTGATGTGGAACGAGATGAAGAAGCTGTTAGAACAATCAGGTAATG
TGTAGGTGGTAGCAGCAAATTCCAGATATGAGGTCAAAGTCACTCTTTTGAAACATTAAG
GAAAAGCTTCATTTCTTTAAGCAGAACCTTAAATGTAATTTAAAATCTAATTAAATCATG
GCTAATTCTTTTATACATGTCATAGCACTTCTGAAATAAGTTTTATTGCCTTTGCCATAC
ACTCAAGATGAGCAAATATAAGAACTTTCTTAAAAAGAAAAATAGCTTATTTAAATACAG
TCTAAATATACCTACTTGTAGAGCAGTCAACTGCAAGGTGCCATTATTAAACTGTCTGTT
ACAACAACCCGTTTCTTCAAACAGGCAGATTATTTTATAGTGAAACTAGTAGGTAATAAT
TACAGTTACTCTAACAGTGATGCACAAAGATGATAGGGATTCAGATGATGGTGATGAACT
TAGGAGCAGTTTTCATAATTAATGTATTACTTAATAGTTACTGTACTGTTATTACCAGTA
TTTAGTCTTATTGGACTATAAGATTTAAACATTCTAATTCATATATATGAGTGTGTGTAT
ATATATGTGCATAGATATATATTTACAGTGTTTGTAGCCTGTAGAATATACAACTTTGTA
GAAAAATGTAAGCATTTTGGCAGGTTTTGCTTTTTTGGTTAGCAGTGAATGAAGAACTGT
TTAGAGAAAATGGGTCAGTCTCATCATGCTGAGTCATCTTTTATTCACTTCAGTTTATAA
TTGTTACTATTATTGTTGTTGCTGCTACTATTGTACTAAAACTTTAGTATTTACCCAGTG
TGGAAACTGTTAAAGAACACAGCTGGGGTCCTAATCACAATTTACTTAACAGTTTTAAGA
GANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGCTGAAGTATGATCCACAGAGTTCTACGT
TTGAGCCATGTGAATTTGAGTACTGTATATATAGATATTGTACCTTTTTGTGAATTTGCT
AATGTTTTATGATGCCGAGGAGAGGAAAACTTCCTAAAAGCAAACCAAATGAGACCTCTC
CAGCTTCCAAATCTTTCAGTTGACAAGGATTCCTTTATTCTGTTAGTTCCCGTATTATTT
TTGTGACCTGCACTCTTGGAAGACATTCATAATAAATAATGAATGTTTATGTTATCTCAG
TCTTCTGTAAATTAACAGTGTGCCAAAAAACAAGGCTAATGTATTTTCTTCAATCATTGT
CTTTAACATGTTTTTAAAATTTTAACTTAGTTTTAAAAAGACGAGATTGTAGTATTTTTT
AATCAAAATTTTTGATAAATTTGTAATACCTTTTAGTCCATCAACAAGCAATAACATTCC
ACTAATGAGGGTTGTACAGTCCATCAAGCATACAAAGAGGAAGAGCAGCACAATGGTGAA
GGAGGGGTGGATGGTCCATTACACCAGCAGAGATAATCTGGTCAGTAATCATGTTTTATT
ACGCTAGTTAAACATGGTTATGAGTTTTGTTCTATGTACTTTTTAAGTCAAAGGACATAT
ATATGTTATGTGTACTATCGTAATATGAGTTACACTGAAATAAGTTACACTTATAAAGCA
TTTTTAAAAGATAAAATATTTAATGTTTTACACGCAGTGTTCAAAAAGGGTCTAGTATCA
TGTCTCAGTAATGAGTGTTGACTCAAAACAATGAAATGCATACAGTACCCAGTGAGTGTC
ATGATGTGAAATCCAGCAATACTATTATTATTTGTTCAGAATGATTTTAACCTGCTTTAG
TTCTAACATAAATGAAGATATGGATAACTGCATGTATGTTTAAGTGTATAGGATTGACAA
CCATGTTACTAAGTTTTTGTTGGACAGTTGAACAGAACTGTTTGCAGTCTCGCTGTTTGA
ATTCCCACTTTACATATTCCACTCTTTTACCTTGTACAACTATTTGTAAAACGACAATAT
GTAAACATCAACTAGCGATTTCTTACTGTTTATTTTTTTTCTCTGAACGTATGTATTATT
TCTGCCTATTTTCAGTTTTGCTTAGTCTTTCTTTAAATAAAATTAAAAAAAGAAAATACA
GAATCTTTGGTAACCCACTCAAGACCCCTTTCTGTCTCTCTCAGACAGAATCTTTCTCTA
AATAAATACTTCTGCTCTTAAAAAAAAATGAGGTGCAGCTAAAGGTAGAACAATTCTAGA
ACTTCATCTGATAAGAACTTCATCTTAAATTACTACAGAAATAGGGAATACTTGTTTTTA
TGTAGACCAGTTATTAGATCTGTCTATCAAAGAGGAAGAATGGTGAAATTACAGTGAGAT
GACTGCAGATACAAAGAATCAGCATGAAATAGTAAGAACAGAGCCTTTGCAGCTAGATTG
CTTAAGTCTGTAAACTGTAAACTTAGGAAAATTTCTTTACATCTAGTAAATATTAGCATT
ATTATTCTTTTTAGAGTTTGCAGACATGTTACTTAAAGTGGCTTTGCAGTGTAACCTTTT
AAAATGAAGTACTCAGCAGACTGAGCTTATTTTAGTAAAGTTTTATATACACCAGTTTCG
TATTTTTTCTTTTTTTTTTTATAGTTTATGTCCTTCCAGACTGAATCTGAAGTTATATAC
ATACATTTGAGGATTCAGTAGTGTAGCAAAAGTGTTGTATCAAATCAATGAGAATGATAA
ATAATCCAGTAAATATCATTGACAATCATTAGCTTTTTTGAAAAATGTAAGGTTGAAAAC
ATATCTCATACTTTACATGTAATAAATCTAAATAGATTAAAGATTTAACTGTAAACAGAT
TATTTCATAAAGTCAGTGGGGGAAAAAAATAAAAGATTGATAAATTTAATTTCATAAGAA
ATTCTTATGTGACAAAAAGCAGAGACCAAAATAGAAACTGGAAAAAGTATTTTTAACTCA
TTCTGAACAAGAGTTAATTTTATGATATGTGAATAAAGTCAACAGATTGTTAGGAAAAAG
ACCATAGGACAGTGGAAAAATGGACAAAGAATATGAACAAAGTTCACAGAAAAAAAATAC
AAATGACTCGTTTGGAACTTGATTTCATTTATAATAAAAGATCTATCAGTTTAAACTTTC
ATTGAAATACCAGTTTTTATTTTTCAGTACATCAGATAGTCTAGTAACATACTGCATTAA
TGAAGGCATGATTAAATAGGGGCTTTTGTGTTGCTGATGAGACTACAAGTTGAATCAAAT
CTTGTGGAGAATAATGTAGCACCATCAGAAAATTACAGGTGCACACATCTGACCCAGCAG
CCCAGCTTCTAGGAATAGCTTATAGATAAATTCTCATTCATATCCCATCTGTGTGTGTGT
CTCTGCATGCATGTGTGTGATTTATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCATTACTGACACTATGGTATACTT
TGTTGGTGAGAATAATGGGTGACAGCTCTCATAATCCTGTTCTTGCTGCCACTGGAGTTG
GACTTGATGTAGCACAGAGCTGGGAAAAAGCAATTCGCCAAGCCCTCATGCCTGTGACCC
CTCAAGCAAGTGTTTGCACTTCTCCAGGGCAAGGGAAAGATCACAGTAAGCAATAAGCTG
GTTGATAGCTTTTTCTCTTCTTTGGTTTTAAGCGTTTTGGGGTGTAATTGTGTTTCTTTG
TGCATTTTTAATGCCCACACATTGTCTTTAATAACCAATACTGTTATTTAATCCATCTGT
AAAACTGCTTTTTAATCATAAAAAAGCTGGGCTCTGGAGTCTTCTCCCCACACTCGGGTG
CTAGCTCTACCAACTGCTATATGACCTTAGGCAAAGTACTTTACCTCTTTGAAGTAGTAC
CTACTTAGAGGGTTGTCAGTATTAAAATGAAAGGAACCTGTAAGATATAGAAGAATGCTT
GGCATCCAGTAAGTCTTAATGAAGTATTCTACTGGTATTAGTATTTTGTTTCATGGTAGG
AGATAACAAAAAATAATAAACTGTTAATATTCACATCATGGTCGTGAAATCTGTGATGCC
AGAAATACTATATTTTAAATGAGATTAAACATTGAGAAATATAAAAAATTATTGAATACA
CATTCTTTACCAATAGAATTTTAAAAATTAAACCTCAGTTTGATTAAAGTTTGAGGGGAC
AATTATTACAAAGGCATAATATAATGCTGTTTTTACTCCATTGCCATTTGTGAGGAAACA
TCATTCATTAAACAAATGCATTTTTATTGAAATAAGTATTAACCACTTTGTTTCAATTTA
CCTATATAATTCTGTGCTGCTGTTGACCTTGTGCTAGACCCTGAGATAGAGCACTAAAGA
AATACAGAAATCATAAGACCTATTTAGAGAAATGTGATATACATTACTAAGTTTTAAATG
GTAGCATAATGCAGTACAGTGCACAAAATGAGGAGTGCATTAATTGAAAAACTTAGATGT
AGATAAAAGAGTAAGCATGAACTTCCCAGCAGAAAAATCCAATTTGGCACTCTGGGAGAT
CACATGTTCAAGCTCAGCCTAGGCAACTTAAATGACTTAGCAAGATCTTATCAGAAAATG
TGAGAGGAGTCAGTTGAGAAATAGATTAGTGGAAAGGCCCCCCGAGTTCAACAAAAAAAA
CACAAAATGAAAAAGTAGTGCATATACACATATAACACCTATCCCCAGCCCCAGTTTTAT
AGCACTCCCTTGGGAAACCATTATTGAGTTTGCTGTGTAATTCTTCTTTAGTCAAGGAAT
AAACAGAAGGAGAGCCTGTCATGTATTATTGACTATATAGTTTTTTTTAAATTAAAAAGA
TTAGGTCGTACTCCATGTGGGTTTTTGTGGGATTTTTTGCAGCTTTTACCCATTTATTAT
ATGCAAATGTATTTCATTGTCTGAATGTTTTGAAGCTTACAAATACTAAAACCCTCACTA
CTCTAATCTCTACCTCTCCCACTCAACCAGAAGTAATATTCTTCAACTTTTTTTTTTTTA
AATTTTATTTTAGCAGTGCTGGGGATTGAACCAGAAGCCTCACACATGCTAGGCAGATGC
TGTACCACTAAGCTATGTTTCCATTTCCCATTTCCCATCTTATCTCAAATATGACTCCTT
TCTGACTCATTATCTGTCATTTTCTATATTATCTTATTATCTCCATTACAGATAATTTTC
CAGTCAATAAGGGGAATGAACCCAGGACCTTCACACTGAGCTACATCCCCAGTATTTTTT
ATTTTTGAGACAGGGTCTCATTAAGGTACTGAGCAGCCCAAGCTGTCCTCAAACTTGGGA
TCCTCCTGCCTCTGGCTCCCAGAGTGTTTGGATTACAGGCATACACTATCATGCCTGGCT
TAGAATATTACAGTTTATAGGTGTGTCATATTTTACTTAACCAATATCCTGTAAATAAAC
TAGTATTATGTATAAATACATTTTAATGTATATATTAATTGTGGACTAGCCTAATTTTCA
AGTTTCACATACCATGGCTTTGTTAATATATCAGTAACTATTAGTAATTTTGTTCTTTTC
TTATATATCATTCTTATATTTTACAGAAGATTTGTCTACCAGTATCTCCGTGTCTAATTG
TCAGATCCAGGAGAATGTGGTAAGTGATTGTTACAGATAACATGTGCATATTGGATGATT
AAGAGAAGGATAATAAAATGTAAAAATTTTAGTAGAGAAATTGTTAGGGCCGACGCCCGC
AGGGAAAGAGACCCCAAGGACTCAACTCTTGGTGAGGGAAAAAAGTTTATTTTCATGCGC
ATGGGGTCCCCCAGGCAAACAAGTGCGGAGGGCCCCGAAGGGGAATTGTGTAGGGTTTTT
AAGGGCGCAGGGAGGCAAGCGAATTTACAGAAGCAGATTGCATTGGTTAATTTTGAGCAG
GATAGGACTTGGCAGAAGTTGATTGGAGGGGTTTGGGGTTGAGTAACCATGGAGACTGGG
GGTCCTAGCCCAGTCACTATGTGCCCAGAACAGAACAGTTACTTGTCTTACTATCTCGTG
AGACAGAACGACCTTGCAGGTGCATTCATTCTTTTTTTTTTTCTCTGCTCTGATAGCTCT
GAGAGTTAGAGAGTTAACCCTTTTATTCCCCGCTCTGGAGAGTTATGGAGTTAACCCTTT
CAACATGAATAACTTCATAGCTTTTGGAGAGGTCGAAATCACTATGAGTGAGGACTTCCC
TGACTCACAAAATTAAAAATAGTAAAACAAACAATTTGAAAAACCAATCAACCAATTAAA
TACAAACACTAAGTCCAAAGGGTTTCACTGGTTTTAAAACCACTTATGAAATGCACAACT
ATTGATGAGGCTTACTCTGCATTCTGCTTTACTCAGGCCCGGTACATGAGCAACTGTGAA
AGCAAAATTCAAAATGTTATGTGAAGTGACCATTTCATTGTTGAAACCATGACCCAATAG
ACATATTCTCTTTTGAAACTTCGTACATTATCCATATATGTTCTCAAAGGGAAGGAATAC
ACAGGATTTAGGCTGAATTTTTTTTTCAGTATTTTGTGTTCCACCAGATTTATTTGAAGA
TCTCCTGTCCTGCATCCACTGCCCAATGCACAAGGCCACACATAGGACAACCAACATGAG
AACTTCACTTCTACAGCCTGATTAAATCATCATGAGAATATAATTTTCCTTTCATCATCA
AAGATTTTTACATCAGATTAACCAGCTCTCTTGCTTTCCCATGTTTTTCCCTGGTTTTTG
TACCTTGAAATGGGTGTGCACTCTTCTCAGCCTTGATCTCCATCTTCCCCCGTATTTCCA
AACATATTCATCTGGGAAACATGTAAAGATCTTATTCGGGGCTTGTTTCATTGTTTTCAA
ATATCTGCCCTTGAAATTCAACTTCCACCACTGTCTCTCATATCCAAAGCTATGTACTTG
CAGAGGATTTCTGCTGAGAAATTTCACAGAAAGCTCTTATACTGCAGGGGAATGATGCCA
CTATGTTTTTACTGCAGAGCTTAAGGAACAGGACTCAGCCAAATGACAGACATGACAAGG
GAAAAGCGTATGCTCAAGGATAGGACATGGCAGAGATCATCTGCCAGGCCCTGGCATATT
TCATATCCCATTGAAAGTACATCCATGTGTCGATTGGCTAGCATTTCCATCCACAAATTC
TGAGCAGTGAAGGCTTCAGAAAGAATATTGAGGCATACCCCGCCAAGAATATTCATTCAA
TTTAAATCTTGCTCTACAAGGTCCTATGTGCCACTGAGGTCTCCATGGCAACGCCCAGCA
TTGTGACTCAGGTCTCCTACTGCACACTTGTATCCTAGAGCCTAAAGTCCAGCTCACAAT
GGTGCTCAGCCAATCACAGCCCATTGTGGTTGCCTGGCAACCACAAGCTTGTGGATTTCT
GTGAACTGTTTCAGCCCAACTCTGCAGCTTTCCACCTCATACAACCACAGCCATTCCAAT
CATGCAGTATTTGATTAGCCTCTCTATGTTGCCTCAGAATTTTTCTTACACTTGGAGTGA
TCAAGAAAATTTGACATATTTTGAGAAGTGGAGGGAAGTCATTGGAAAACGTTTTGGTAT
GTCTGAGGTCTATGGGTTCCAAACTTGACTACCCCAGTCTTTTAAATTTTCAAACCTAGA
GCCTAAAATCCCCCTCACAGTGATGTTCAGCCAATCTGAGCCCAGTGTGGTTGCCTGGCA
ACCACAAGCCTGTGGATTTCTGTGAACAGTTTCAGCCCAACTCTGTAGCTTTCCACCTCA
TACAACCACAGCCATTCCAATCATGCAGTATTTGATTAACCTCTCTAAGTTGCCTCAGAA
TTTTCTTTGAAGTTGTGGTGATCAACAAATTTGACATATTTTGACAAGTGGAGGGAAGTA
ATTGGCTCTGTCTTTAGCTCTGTTTGTGGTATATGGTGTCCAAAGGTGACTAGCCCAGTC
TATTCAATTTTCAAACTTAGAAAGCCAAATGTTTCAAGGGAGGAAAGAAAATGCCACAAT
GATTTGGGTTCTGCCAAGTTTCTGGTGGCTTGGGAAGCAAACCTGCAAACCATACATGCA
GTCTCTGCTGGATTACTGCCACCATGGTAGTATCAGTTAGCACTGAAAGCCAGCAACCAG
AAGATGAGACCCAAAATGAAAGTGAATCCTTGCAGTGCATGAATATTTGGAGTGCCTGCT
TCAACTATCCAGCTTCCTCGGGGTTCACTTGTCTGCAATCGCTATTTCAAGGAGAGCTGC
AGCCCTTCCAGCATAACCCTGAACACTAAACATGAGGTATGAGCACAATACCTTATCACC
AGCAGGTTTTCCCAGAATTCCAATGTAACATGGTGAAAGGGAAACCCTTAGAAAAGGGAT
GCAAATGCCCCTTTCACTAAAAATGCCAGGTATTTTATCATGGCATGGAATATTTAGACT
CCACAACTCATGTAGTGAACCCAGGGACCAAGACCAAGTGTGTCTAGTTTAATGTTGTCC
TCTTTTTGGAAACAGCATCTTATGTAGTTGTTGAAAGAGGCCTTGAGATAAATTCGTAGC
CCAAGATGGACTGGAACTCCCAAGGATCCATCCACCTCAGCCCCCAGATTGCTGGGATTA
TAGGCATGAGCGACCATGCCAAGCATGTGCACAGAGATTCTTACATAATTTGTGAAATCC
CACTACTGGTCTATAGGTAGCTTCTGTGCTTCAGGCTTTAGGAATATGCCTCTCTTTGTT
TTGGCTCCCCTTGTTCAGGTGTCCATTTCTATTGTGATAAGCTCCAAGGCCCCAGGCAAG
GGAGTGGCTGCACTTCCTCTGGTGTGTCCTTGGATGATTACAGCCCAGGTGAACAGGGTT
CAAATATATTGGATCCTGTGCATTTGAAGAGGAAATGAGTAAAGATTCATGAGTTAACGT
GGACATGCCAGGGAATTGAGGGGCCATGATAGAGACAAAACTTCAGGCCATGGGCCGAAG
GCTGAGGATTCTCTACCTCTAGCTTCTTGAATAGTGGGCCTGCTGAGCACTTGTGTGCTC
TCAAATGTAATTTGATGGGTTTTGTTTGAATTTATTTTGTTTTTTGCTTTGGTTTTTTAC
ATGGAAAGAACTGTACCATGGTTTAAAGAAGCTGGAGTGTCTTACCTAAGAGAGATTTGC
AAAAACGTACAATTCAGCAGCCAAGAATTTCTCAAATGCCCTTGGCATTTTAAAAAAAAG
TAACAAAAAGTTGAGCGTGTCATGTCCATGTCTCTTTACAAAAGATTTTTCCTCCTATTT
GATAGGAATTACTGTTTCTTTGAAAGGTCAACCTGCACTGAAATAAAGATAATCCCTCCT
TTCCTCATTCTGCTTGAAACCACATTCTTTGTTAGTTATATTTTCTTACACAGAAACACT
TGGAGATGACTACAGCAAGAGTTTCCCATTGGTGGAATTTCCACGGAGACACATGAAGTA
ATACTGCACAACTTCAAGTGAAGTGCACTGTCCCTTGACAATGGCAAGTCTGGGCAAACC
TCTAGTAACTGAAAATCTTAGAAAGTCTAAAAGTGAGTGAATGAAAGTGGGCCTCTCCAC
ATTGGGTCAGGGCCTCTCCTGAAACACACATTTGTGGAAAAATTAATTATGAGAAACGCA
TGAACTCCCGAAACGGAATGGAAATTTTCTTGTTTAGGCCTGGAACGCTATGGCCTGGAG
CCCTGTGTTTCTAACTGCATGAGCAAAGGGTGAGCAGAGATCAAAGTAAAACACACAGCA
TTTAGGGAACTCGATATTTAACCAGGTGTCCAGAGTAGTGGCAAACTGTACTTGTGCCCA
TTTGCTCAAATCCTGTCTTCACAAGAAAGTAAATTCCAGCACGACCAGTGACTAGAGGAG
GACACATTTCAAAGGACTTGTAAAAAGTCCAACCCTGAAGTTAGCCCAACACTGAATTTA
GATGAAAAGTAGCAGAGTCTGTTAGTCTTTGAAGTTTTAATAGGAGAAACTTATAGCGTG
TAATAGCTGTTACATGAATAACTTCAGAGCTTTTGGAGAGGTCGAAATCACTATGAGTGA
GGGCTTCCCTGACTCACAAAGTTAAAAATAGTAAAACAAACAATTTGCAAAAAGAATCAA
CCAATTAAATACAAACACTAAGTCCAAAGGGTTTCACTGGTTTTAAAACCACTTATGGAA
TGCACAACTATTGATGAGGCTTACTCTGCATTCTGCTTTACTCAGGCCTGGTACATGAGC
AACTGTGAAAGCAAAATTCAAAATGTTATGTGAAGTGACCGTTTCATTGTTGAAACCATG
ACCCAATAGACATTTTCTCTTTTGAAACTTCGTACATTATCCATGTATGTTCTCAAAGGG
AAGGAATACACAGGATTTAGGCTGAATTTTTTTTTCAGTATTTTGTGTTCCACCAGATTT
ATTTGAAGATTTCCTGTCCTGCATCCACTGCCCAATGCAGAAGGCCACACATAGGACAAC
CCACATGAGAACTTCACTTCTACAGCCTGATTATATCATCATGAGAATATAATTTTCCTT
TCATCATCAAAGATTTTTACATCAGATTAACCAGCTCTCTTGCTTGCCCATGTTTTCCCC
TGGTTTTTGTACCTTGAAATGGGTGTGCACTCTTCCCAGCCTTGATCTCCATCTTCCCCC
ATATTTCCAAACATATTCATCTGGGAAACATGTAAAGATCTTATTCGGGGCTTGTTTCAT
TGTTTTCAAATATCTGCCCTTGAAATTCAACTTCCACCACTCTCTCTCATATCCAAAGCT
ATGTGCTTGCAGAGGATTTCTGCTGAGAAATTTCTTTTTTTGTGTGTGTCTTTTTTTTTT
TAATTTAAGAGGAAAAAGAGAAAAACACAAAACAAAACAAAGCAGTGTAAGGTTACACAT
AATACAGAACTACAAAAAAAAAAAACATAACAGTAAGAAATCACCTGTTAATAGATTACA
TAATATCATCTTGGAAATAGTTGCTCAAATCACAGTATCAAAGAATACAAAGTAGACATT
CAAACGGAGAGACTGCGAAACAGCTGTGTTCAATGATCCAAAAACATTAATATAGTCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATCATAGCCCAAATATCGAGTA
TTTTGCCTAAGACTTTATGGATAATAACTTCCCTAAGGAGTTCTGCTTGATGGGGGAAAC
TAAAACATACATTTTAAATCACAGAAATAAAGTTAACTTTTTCACTAGAAGAAATGATAT
TAAATTACTACAAATTGAAATTAGGATATTACAAAATGATAAACTAAAGAGAAGGGAGAG
GCTGCTTGTTACTGGAGGGGAGAGGAAGGAATAGGGATGGACAGCTAAAACGTTATGCGA
GACCAGGGAACGGGATAAGCAAATAGAAGGCAGCCATAAATATAGGACTTCTAAGGAATG
GTGAGTAGGTTAAGTTCAGCCGTTGCCTATGGGTACCTGTAGGATTTTATAGTAGGTCGG
CAAACTTTTCTGAAAAGGGCCTTGTAAGACGCTTTATAACCTACATACGTAGTTCTGGCA
TTGTAGCAAGAAAGTATCCATGGGCAGTACATAAATGAATAACCATGAGTGACTCCCAGT
AAAACTTTGTGAACACTAACAGTGATCTCGTGTAATACTTGCATATCACGGAATACTATT
TTGATTTTTCTGGGTCATTTAAAAATTTAAAGGCCATTCTTAGATCAAAGGTGTATAAAA
CAGAGGTGGCTGGTTGGATTTGGCCCACAAGCCAGCTTGCTATCTTCTGGATTGAAAAAC
ACTAGAAAACAAAGAACATTAGTCTGTAGATTTTCTCTTCATAAAAATTTCTCATTTTTT
CCCCCAAGGCACTAGCTTTTATAGTTTTCTAACACACAGTGCTTGGAATTTCTAAGATTG
CCATGAAGAGACTAGATACCTAGTATTATATAAGATAGAAGGTTTCCAGGAAATACAATG
GGTATCTCTTACCTTAGTGGTAGGTAAAATAGATAACATATTCTTGGGGAGAGAAAAAAA
GATACAAAGATGAGAGCACAAACTCTGAATGGTCCCACGGGGGAACACATCTATACTTTT
CTTTTCTGGCTTTTTGAGACTAGGCCTTACTATGGTGTTTGGGCTGGCCTTGAACTCACT
TTGTAACCCAGCCTGGCCTCAAACTCATGGCAGTCCTTCTGTCTCAGCCTCAGCATGCGC
CACCACTGAGAAGAAAAAAGATTCAGATTTGGAGTTTTTTAAGAAACCTTCTCTGGCAGT
TATAAATGTATATATGTTGGAATGCCCACTTACCTAATTTGATTGAATCAAAATTTGGTT
AAATTTAAAAATTGATTAGTTGAGAAGCATATAAAAATGATTTGTACAAACCTTAAAATT
TTCATTATAATTTAACAATATATCTGCCTTTCCGTGGCTTTTGAGGCAGGCCTGAGGCGT
TGTCAGTGAGTGTGAATCTACCAAGAGGAGTCCCACTTAGTCTTTCTTTTGTCGGTCATC
CTTGTGATGCAGTTCTTGCACTGCACACACCTTAAGTTACTGCATGAATATTTTGACAGC
AATAAGCACTAATAAAAGAAGGGGAATAAAGTTGGGGGCAGGAGGAGAAAGATTAAAGAG
TGATTTTTGGTATAGACTTTCTCTTAGATTTTATAAGTCTTTTAAAATCAGCCTAATTTT
AAAATCAGCCTAATTTCAATATTAACTTTTGTGTTTTTCTTTCAAATCAAAGAGGTGTCT
CATTACTGATAAAATAGATGAAACATTGTTCTTAACTTTTTATGTTAATTTACTTTTTTT
TAGATCACCACTTAATAAGTATGGGATTTTATTTTTCAAAACGTTTTTTCCTAAGGGTCT
TTGTATAGAATACTTTATGCTTGCACATTAGCAACATAGTATTTGGGCTTGGCCTTTTCT
AGAATAGAGAAGGCTCTGTTTCATAAAATATTTTGTACTTACTGAAAATTGCTCTAAAAA
CTCCCCAAAATGTATTTGAGTCAGAGATATGACATTGTTTTATAGAGATAAGTATCTGCT
ACTCTTGCTGATAGGACATCAGTACTGTTTACCAGATCTTGCAGATGAGGTCCTTGGCTC
AGGCCAATTTGGCATTGTTTATGGAGGTAAGCAGCATCAGCCTTTTCTGTGTTTTATGTA
TTATGGGAAAACTGTGAAATTTAAAATATCTGTCAGCTATTTTGTCATATAATTTTATCA
AGCTACCCTTTTTTTCAAAGGCTGGCTTGCATCCTTTTGACTAAATTCTTTTCATTTATT
TCAGCTGCAAGTTTTAAAAAATAACAGTGAAAAAATCAGAAAATTGGTTTTTGTAGTAGT
CTTTATCTCCTCTCCTAGATCACATAAAGATGTTTGGTGGGGGAGGTTGAAGTTTTTGCT
GGGTTCTGTAGACTTGCTCGTTAAAGGATATTCTCTACTAGTTTTCCAACATAAATGGTA
CTGTTTTAGTCTGCTTTTGGCACGAGTGCTCCATATGATCCAAATACCTGAAATCTTCAA
TATGAGGAAGTTTCTTAAACCTCTTGGTGTCTTGATATTTTCATCTGTTTAATAGAGCTA
ATAAAATTTGACTTACATAGCTCTGAGGACTCTGTAATATAATGTATCTAAAAGTACCTT
AAAAGCTATAGTGGAGACAAAAGAAATGTTAACCTTAATGTCTCTTTTCAAGACTTTTAA
AATAAGACTCTTCATTGCCTATTCTGCATCCAGTCCTCCCCTTTTTCACACCATTCTTGG
AATGAATCTTTCCGGAAAATTCACGTCAGTTACTAGTGTTGTTTAATCATAAAGTACTCC
TGTGTGGCTGTTACCTGGAGATTAATGGCCACTACTCTTTACAGGGCATACGAGCCTCTG
TGGTTTCTTCTAGCTTCTGATCTCACTACAGTTCCCTCTCTGTTTACTTCTTCAAGACAT
ACTTATATGCTTGTATATTTTGTTCCTGTTCCTACTGTAGTACTTTGTACATCTAGTAAA
TATTTATTCATACTTGAAGTTCGTACTAAGATTTTCACGTCCATCTCTGCCTTTCAGTCA
GGTAAAACTGCTGTTCTATCACTTGGCTTCTAGTGTTGTCGTCCCACTGAACTTTGAGTG
TAGAGTGAGAAGCATCTGGGTTTCTTTATATTCTTCGTCTATCATTGTCTTTGACATTCA
GTAATCACCCAGAAGATTTATTGATTTTACATGCTTATGCAATATAGTGGTGCCTTGGTT
CAAAAAATTAGTTCTTTCTCTAGAATTGTGGAAGCAATTAAATTCATGAACCAAGGTACC
AAGGTATCTATGACTTTTAAGACTAATGATATCTCTTTAAGACTTCATCTTGAAGTCACA
GCTGTCTGATGTACCCTTAGATTCTTACCAAATATACAATTTATCTAGTCTTTTTTAGGA
GGCATACTTTTATGATTATACTTTCATGACAGCTGAGTTATTTTCTTTTTTTTTTTTATC
AGTACCAGGGATTGAACTCATGACCACTTGCTTACAGGGCAGATGCTTATGCCGCTGAGC
TAAATCCCCAGCCCCTAGCTGAGTTATTTTCAAATAAATAGTTATATAGAGAATATCACA
TCACTTATAGGTTAAAAGAAGTAATATCAAAAATCTGCCTGTTTTTACTGTTCAATCTCT
AGCATCTAAAACAGTACTTAATTATATAATACGTGACTATTGATTGCATACTTCCACCTC
ACAAGCTCTTATATCTACATTCTAGAAGTATGAGGACTGGAGTGTGGGAGTAACTGGTTA
ATTAATTACCTGAGGATAGCCCAGTGAACATAGAATGAAATTTATTTATTACATAATATT
TCCATCTTGATAGTCTCTCAAGACTAGGTCGGGGTATTTAACTGCCATGTATATAACAAA
GTAGATTCTTTTCAGCAAACAGGTTCTTTCAAATTTTCTGCCATTTCAAATCATGAAGCT
GCCTTCATCAGGGGCAAATACTATCCAGGGAAAATGTAATTCTTAAAGCAAAAAGTGTGG
AGAAAGAAAATGAACAGAAGAATGGACCTGAATCAAGGCTGGCAGTTTTCTGAAGGGGGT
TTCAACCAAAGGCCTAAAGTAGTGTCTTTTTATGGTCTTTTGGCCATCTCAGAACTTTAC
TACAGAAATGTAATGGTCAGTTAATTAGAAAGAAACCACTTGCCCCCCAGTGAGCCCACC
TCCAGGGGCCCAGAGAAGAAGCATCATCTTGGTGAATCTGTCGCACCTGGCCCAAAGGAG
AGGAAACCACACCCCCAGTGAGCCCACCAGTTATGGGCCTGGAGGAGAGGAAGCTACACC
ATCTGGGAAACATGGATGAGCAGCTACCCGGCACCTCTCAGCCACCCCAGGACTTCAGAT
CGGAGGAACCCAGGTGCCTAGCTCAGCCCCTGCAGCCAATGCAGGAAACACCTAGGACTC
AGCAACTGGCTGATTCAGAGGAACACAGGACAATGTCAAGATGAAGGAGCAGGGTGAAAT
CTCAGACCTCCAGCCACCCAGAACAAGTCCAGGAGACATACACACAAAAGAAATTAGACG
TCACACTCCTGAAGTTTCTGAAATGATAGTAACTGAAGTAAAGAGACAACTTAGTGCTTG
TTCTGTTTGATTGACTTTGCATGCCTGTGTCTGGTAGTCTGAGCCTTTATTTAGAGGATA
ACAATGTGCACTACACTATGATTGATTTCCTACTGTCTTGTTTTTGAAATCTAGTATCAT
TTCCATTGTTTTATTTCATTTTATTGTTTTGTTTTATTCTCTTTAAAATAAAATAAAAAG
ACACCAGTACATATAATTTTATTCTATGATCAGCTTCCTAGTAGGGTTTTTTTTATTATG
CATAAACTGTCATTTTGCTTCTTTTTATTTTTTAAATAGGAAAACATAGAAAGACTGGAA
GAGATGTGGCTATTAAAGTGATTGACAAGATGAGATTCCCCACAAAGCAAGAAAGTCAAC
TACGTAATGAAGTGGCTATTTTACAGGTAAAGAAAAAGAGCTTCTGTAGACTTTAATTTT
ATATTTTTATCAGTTTTCGACTCATCTGTTTAGTGTACAAATAAGAATAGATTTGATTTT
GATTTTTATAATCACTTGGCTAAGAAGGAAGCGAGGTAAAAATCTGAATTAACTACATAA
TTCCTTTTTATAAGATTATGGTGATGTAGGTATTAAAAAATACCACTATTCTGTTGAATA
CTAGTAGCTTACTTAGAATATACTTTGTTTCCTTTGGATTTTTGTTTGTTTGTTTTGTAC
CAGGAATCAAATTTAGGACCTGATGCTTACTATGCAGATGCTGTGCCACTGAGATATATC
CCAATTCTGGAATATACTTTTATAAGTACTGTTTTGAAAAAGTAATAAAATTTCATTCTT
AATTCATTACTCTAGTTCAAAATACTTTGATACTCCTACAATTCATTATATCATCACAGT
TAATGTGTTAATTATATCCTCGTATTGCATAAAGACTGATAAAAAAGATATGCCTGTCAG
AAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTTGTGCTAGAATCTGCACTTAGTCTACTTTTTCTCA
ACATTACCCAGCAGGAACTAGGCAGGTTGGGATTCTGAATCTGTCTCCAAACTACATGCG
CCTTTTTGTTACCTTGTGCACCTATTCTGTGTGTATGCACATGGAATTGTGACTCAGGTG
TTCTTACGCAATGTGTGCACTCAACAAAATCTATAAAGATGAACTTCTGCCCTACTTTGT
ACAGAAATACTGTAATTTTGTTACCACTGCCCCAAATTCACACAACGAATACATTTTTAG
ATGAGAATTTTTATAAATCATACATTTACTGAAATTAATTCCCCAAGATTTATTCATATA
AACATTCCAGATAGACTTTTTCACATGGATCAAAGGGCATGTACTGCTGCTCTCTTACAC
TCATAGCACCTTTTGGCTTACTGTTCCCCCTCCAACAATATCACTGTTTTTCTGTCTTTA
CCTGGTGATATTCTTACATTTAGTCCTCATCAAGTAACCTAAAAAGTCGGCTGAACTCCT
GTGGCTGACCTTGCTGCTGTTACCTTCACCTGCAGCACCAGTGGCATCCACAGCTTATCT
TTTCCATAGCCACATCTCTTTTTTTCTTCTACTTTCTTAAACCTTATTAAGGAAAAAAAG
CAGTGGTGGTGGTAAATCTCTAGAACAATTAGTTTTCTAGGATTCCCTCCTCAAAAGTGA
GAACTGATTTCCAAATACATACCAGAAGTTACCTAGACCCCATTTGTTCTAAGGTAAGCT
GAAGTCTATAAAGTGTTCATCTTCCACTTTTCCTGTCTGTGATCTGTCTTTGGATTAGCA
AAGCTACTACAGCTTCATTAATTTTTGTCATTAGGTCTTTGAGTTCTTTTGTGTGTAGCA
ATTACATAATTAGAACAGCTTCTTTAAAAACTGCATCTCTAATATCATGACCAAGAATGT
TTGTCTAAAGTAACAGATAAGCCCTCTTGTTTGATTGGCTTTAGCAACGACATCCTCTGT
TAGGTGCTCCAGAAACAAAATGTGTATTGCCGTAGCCTTCAGGTGAGGGAGGGCAGCCAA
AGCTGTTACACCAGATTCATCCAGATTGGCCATGGCTCTGCATTCTTAGTTACATTGTCA
ATATTGTGTATGTGTGTACATGCACGCATACGCGTGTTACCAGGTACTAAATCCTTTATT
TTTCGGCATTATCTCCATATTCAAGTCTAACCTCTAAACCGTGAAGCCAGTCACTTGCTT
CCTTACCTTCCTGAATCTTGAAAGAATAGTTAACATCTCTGAGATATATTTCAAAGAAGT
TGAGCAGTTATTGCTGTGGATGTTTCTTAAATTACCTCTTTGTTCTTATAGTGTCTGGTT
GTCTGGTTTTCTGGTTTTCAAGCCAAACAATAAATTTCCTAAATTCTGTTTCGTCTTTGC
TTTTGAAGCCAGCAGGATTTTGGTAGCTGTCAGCTTGCTTGGGAAGATGGTCCCTGCTTC
TTGCTTAAGAGGCTCCCAGCCCTCCACCGGCAGAGCAGAAATGAGGTGGAGCAGGTGACT
CAGGCACCAGTGACTTGTGCCCACATTTTCTTTTTGCTTTTTGAGACAGTTTTGCAGTGC
AGTTCAGGCTGGCCTTGAGGGTTTTGTTTTGTGCCAGGGATCGAACTTAAGACCTTGTGC
TTGCCAGGCAGGCAGTTATGCCACTGAGCTAAGCCCCTAGCCCCTTGAACTCATTTGATA
GCCCATGCTGGCCTTAAACTAGAAATAACCTTACAGTTTACCCTGAAATGTCGAGCCTCT
TCCCTTAAGCACTTGATGGTAGACTCTGTATTCTTATCAGTTAGAAATGAACATATGCCA
CTTTTGAACACTTGTGATTATAGTCATTTTTATATTTACTGCATTTTGTGTCAGTTTCAC
TTTGCTTTTTTTTTGAAGAAAAAAATAAAATTTCAAAGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCACCAGGA
ATGCTCACACTTGTGACAGTATGTGGTGTATGTGTGATATACTCTGATTTTTTTAATTCA
GTTGAGTTTCATTTTTTAAAACAATGCTGTCTGTCACCTGGCAAGCACAAGGCCCTGAGT
TCAATTCGTGGTACCAAAATATAAAAAACATAAAACCATGCTAATCTTGATCAGCTCAAT
TTATTTCATAACCTGCTAAATCAAAACTCATTTTTGAAACAACTGTACTGTTTTTATTTT
TTAGTACCAGTTATCAAAGCCAGGGATGCTGTATCATTGGGCTACAGTCCCAGGTTTTTT
TATATTTTATTTTGACGTGGGTCCATGTTGTCCAGGCTGGCCTCAAACTTGAGATCTCCT
GCTTCAAGTATCTGGGATTATTAATGGTGTGCATTCACACCTGCTGAAAACAATGTATTT
ATTCATTTTTTTTAAATCTTTGGCTTTTAAAATAGTACTCATGTTGTTAAAGCTTGTGTG
ACTAAAGTGATTCCTTATCATTGTGACGTTTGAAAAGGTCCCATAATAGTTGGTGCTGTA
TTTTAAATAAACTGTTTCTAGACATTATCTTATTTGATCTTCAAAATAGAGTAGGCAAAG
GATGTACACCCTGTGGCTAAAGCTAGAATCCAACTTCTTAATGTCGACTTTTTGTGATCC
ACATTGTTCCCATTAGGAGCAAAGGGGAAAAAATGTTATTTACTTGATAATCTTTTTTGC
GCTGTACTTTGTACTTCTTTATTCAGTTGCCAGAATGTTAAATCATCTGTATCAAGATAT
TATCTAAATCCTGGCATTTAATGAGAAAGAGAAGAAGAATGTTTCTTCAGGGTCTGCACT
CCTAGTGTTTAAATACTCAAATAGAGAAACAACAAGTTCAGTACTGACAGCGCAAGTATC
TTTCATAAAATCATGTCAGAGTCTGTATCCTGGAAATAGCACTTCTACTTTTTTGTGTAT
CCCGTTGGTTTACTTGTGCCTACTTTTTCTAGAGGTCCAATCCCTTTTCTGTGAACTTTA
TGTTCTTTTTCTGAAGCATTCTGAGAGTCAGAGCATTTCTTCAGGAAAGTACTTGGCATT
TGCTTATTCAGCAGTCATCAATCACCAAAATCTGACTTCTACAAAAAAATGGAGGAGTAT
ATAGTAGGGACTGAGGCTGCGTTCACGACTTTTTAAAATCTTATGTTAACTAGCAGTAAT
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAATAAGTAATAGAATCGTATGTCGAGGTCTCACTATTTACACTACAACACCCTGAACA
TATTTATTAGGTGTAGTATAAACTTCTGATAATATGTTATCACTTCAGGCTAGGGATTTA
GCTCAGCAAGGTTGTGAGTTCGATCTCCAGTACCACCAAAAAAGAAAGTTAACACCTCAG
TCCAGTCTTATTTGTACATGCAAGACAGTGGCTCTGGCTGCTCTTCCACACTATCCTGGG
AATAGAGAGCAACATGGTTATTGTTGGAAGAGATACGTAAGCCTACAATCAGTCTGTTTT
ACTCATTTGGAAAGAATAACAGTTAATAAATAGCACTTAAATACTACGGACTATTCTAAG
TTCTTTACATATATTACGGACTATTCTAAGTTCTTTACATATATTAAGTTGATTTTATCT
TTTCAACAAGTCCAGTTTTGCAGATGACAAAACCAAGTTACATCATAGGTCAATAACTGA
CCCCATATTGCATCACTAGGAAGAATTATACGGTGTTTTAGCCCAGCAGTCTGGCTTCAG
AGTGTGTGTTTTAAATCTGTATTCTATACAACCTTCTTAATCAAATGAAAATTTCACAGG
CATACTTAATTCAGCAAGCATTAATGGACCACTTTACATGTAGAAAAGTCCACGAACTTG
AGAAGCAAAATTTCCTCAATGTTGCATTTCTATGAAGTAGACAACCTGTGGCAGAGTCAC
AGGTTTGGGGTACTTTATACACCCAATTTATGTATCTAATTTTGTATTTTCCTTTAGCAA
TTGATTTGATAAACAACTTGCTTCAAGTGAAGATGAGGAAACGTTACAGTGTTGACAAAT
CTCTTAGCCATCCCTGGCTACAGGTAAAAAAACAAACCTGGTGATCCTTATACAAGCAGC
TCATTCATTTGTATGGCCATAGCTCCAGGAGTTGTGTGGTGACTACAGGAACTGAAGCAG
TGACTTGGTTTTCTGTAGGCTCTGTATATTAACTTCAGTTTTTTGTAAGATTAACAGGAC
ATACATTTTTATAAACTATATTTTATTTTAAATGTCTGCTTAAAGGTTTATTTTTGTATT
GAAAGGCCCTACCCCATACACAGTCTAAACTGGCTTGATCCACCATTACATAGATTTGTC
AAAATGAATACAGTTCGGAAACATGTTAACTGAAATAAACCAAACACACAAGCTTAATAA
TCATGGGAAATCCAGAGTAAAAAAAAGCAAAATAAAAGGCAGATAAAAGAAAACAAGGTG
ATAGATCTTTGCAGTGGGAAGGGGACCAGGAGACATGGGGAAGCAGTAAGGGGTAGGAGG
GAAAGGGATGTATAAAAGAATTACAACATGTGATGTGCATGTACCAAATACCCACAATGA
AAGTCGTCACTGTGCCTGGCACACATAAATTTTAAAAGCCTACAAGAAAAACTATGTTTC
AGAGTAAGGAGAAAAGCCTTAGAACTATTTTAAAGGGAATGAGAGGGAGAATTAACTACA
ATTTGGTGTTGGGACTCCCAACAGTACAACACAAAACATTTTAGTGATTGTTAACCCCTT
CAGAACCCTGAAACTTGGTTGAGTTGGGTTTGGTGTTGTGTTGTGCTGTGTTGTGTTGTG
TTGTGTTGTGTTGTGTTGTGTTTTGAGACATGGTCTCAGTGAGCAGTTCAGGGTTGGCCT
TGAACTCACTCTGTAGCCCCAGGCTGGCCTCATACTCACTGTGGTCTCCCTACATCAGCC
TCTTAAGTGCTGGGATTATCGGCCTGTGCCACCCACACCTGGCCTGAAACTTTTTTTTTT
TACTTCCATTTATTAGAAAGTATTTTCATTTTATTGGGAAATAGTGGGATTTGACAAAGT
GTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1285, 11545..11683, 13548..13679, 14742..14899, 16167..16359, 23351..23428, 25370..25553, 26976..27099, 29558..29635, 30187..30318, 30320..30464, 32426..32478, 39974..39997, 40000..40045, 42819..42925, 63728..63889, 63990..64088, 66407..66674, 68457..68542
1001..1285, 11545..11683, 13548..13679, 14742..14899, 16167..16359, 23351..23428, 25370..25553, 26976..27099, 29558..29635, 30187..30318, 30320..30464, 32426..32478, 39974..39997, 40000..40045, 42819..42925, 63728..63889, 63990..64088, 66407..66674, 68457..68542
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved