Cavia_porcellus Locus RPS3A
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPS3A
Cavia_porcellus
RPS3A
GeneScaffold_4143
SNORD73
3062..3134
6993
TCAAGGCATATTGTGTGCTCTTAGCGGTAAGGTGCCTTTGCTTGTGCCTTTCTTGTATT
TTTCTCAGCTATTTTATCCCCACCCCCCATACCGCGTTTGAACCTTTAAACTGAGTTAAA
TCCTCAGACTTTCTAAATTTTTAAGTTTTAAGGGATCTTGCTAAGTTACCCATACTGAGC
CAAAACTTGAAAGGATTCTTCTTGTGGTAGCTTCCTAGAGCGCTAGGATTACAGGCTATG
CTGTACTGTAGTTTTTAACAAGTTCAGTAGCAATAGGTCTCCTTGGAGTAGGTCTGGGGC
AAACTATGTCTAGGAGACCAAATCTTTTATTAAAAGAAGAAATGAAGCTGAACTACCTTT
AAACATGCAGAGATATATGCCTGCCCGACATATGCATGTCGCTTTATAATCTGTCTGGAA
ATGAGATTTTGTCATTTTTAGAATAATGTATTTTTAACTTACCAAAGCCTGTTTACCCCA
AATCTATAGTTTCTGTAGTAAATACATTTTTTCAAATAAACTTACTCATTTTTCCCCCCT
CTACTATAATTAGGCTTTATGATTTCATACAAGTTCAAAACAAAAACAAAAAAATCAGAT
TTAAAAGCTTGCCAGGGGACGAATCTTGGTCACAGATCGTGTGTCGCCCGGGCTGGGATT
GATCTTCCTGTCTCAGCCTCTGACAATACAGAGTTCAAGTTCAAACGAAGCTGAGTGGCG
CTTACTTCCTGAAGGTAGAGTAAGAGAAACTAGGAAAGTCTGCACAGCTGGCGGCCGGCG
CCGGCGTCTCCACAGCGCGGTCCTTGTGAAAGCCCGCGGCGCGGCCTCCGAACACGCGAG
GGAGCTGCTGCAGCCGCTGTCAGAGGAGCGGCTGTTGTCGCGATATTCCCCAGGCAGGAA
GGGCGAAAGGTGAAAGGTCACGTAGACGGCGCGCTCCGCCCCGTACGCCTAAGTTCTCGC
GCGAGTTGTACTTCCGCCCTTTTGGCTCTCTGAGCGGCACCATGGCGGTAGGCAAGAACA
AGCGCCTTACGAAAGGCGGCAAAAAGGGAGCCAAGAAGAAAGTGTAAGTGCCGATTACCA
TAGTTCCCTGCTCTTTAGGGTCCTACTGGAGTCAGCGGGTGGGTTTTTGATGGCGGCGTG
CGTCCGATGGCGAGGATGCGATCGGATGCGCGGGCTGAGGATGGTCGGGGCACCCTGGGC
CACGGCGGCCTGATTTTCCGAGGTGCTACGTTTCGGCACTCTTTGCTTTACATTCTCGGG
TCCGCAGCGTGTGACCCTTATGGCCGTCCGGAATGAGGCTTGCGTGTACTGCTTTGTGGG
CTCGAAGGTTGCCTAAACATCCAGACTCTTGATGTCACTCAGAGCTGGAGTCCAGGGAGA
CTTTGTCCTGTCCGTGTCCATTCAGGACCTCGTACCCCACCTCTAGTGAGACATGGGTGT
CTTGACAGGCTCTCAGGAGCCATTGAGGGTGTTAGTTACCAGTAAGTGTCTTTAAGATCC
AGTAAAGTTCACAAGACGTGCAGATTACTGGAGGACGTGCTGCACTGGGAGGACCGGTCG
GGGTGGGGAGAGGTCTTTAATTTTCAGAGGCTTGTGTCTGGGCAGTGAGGGAAGAATAGC
TTTGGATCTGCGGCCCTCGCCTCACTGAGAGGGAAGTTAACTCCCGCAGAAAGTTGCCAG
TTTATAGCGTTTGATGTTAAGTGATACAAAAAGGAAACAGGAATCGCAGCAATAAGTTAA
TTGCAGTGAAATTTAAGCATTTTTTTTTAAATCCAGGGTTGATCCATTTTCTAAAAAAGA
CTGGTATGATGTGAAGGCACCGGCTATGTTCAACATAAGAAATATTGGAAAAACACTAGT
CACTAGAACTCAAGGAACCAGTGAGTATCCTATATTTGGCCTCTTAGGTTGGGGCATGTG
TGTTGTAGTAGGTGTCTTGGGTAACTGTTGGTCTTGTGGGACAGTGGAAATCTCAGCTCT
TCCTTGCAAGTTAGGCACCTGGATTGCTTGTTGTTTGTACACAAGGAGAAGCCAGACGGT
GCTTTTAGAATTGAAGAAAATGCGGAATTTTGAATGTAAGTGGACATTACCATTAAGCCG
ATGCAGTCTAGATGGATTTGGTGACAAAGGTTAAGATATTTGTAATTTGACATTAACTTC
AGTTTGTCTCACTTGTAAGCTAGTCTGTGTTTTACGTGATTCCTATTATTGACAAGGCCT
GATTATTTTGTAGAAATTGCGTCTGATGGGCTCAAAGGTCGTGTGTTTGAAGTGAGCCTT
GCTGATCTGCAGAATGATGAAGTTGCCTTTAGGAAATTCAAGCTAATTACTGAAGATGTT
CAGGGCAAAAACTGCCTGACTAACTTCCATGGCATGGATCTCACCCGTGACAAAATGTGT
TCCATGGTCAAAAAATGGCAGGTGAGACCAAAAGCTCCCTTAGAGTGCTTAGTGTTTTGG
GGTATGTGACCAGAGATGGCATGGTGTGGAAGGAACCTATCCTGCAGTGTAGACTGGAAT
TTGACTTTAAGTCCTTGATCTCTTGATGTCAAGTGCACCTCTGCGTTTGGCACACCTGAC
TGAGTTTATGCATCATTGACAAGCATCATTCTGTTTTACTTACACTTAAATTGAAGCCAG
AATATTTTATTGGGTTGTTACCACAGTGTGTTTTTGGGCCTTTGGTGAACGAGGCTTCGG
AGCATCTTGAAAGTCTAGTGAATTTATGGTGAAAGGGTAGAGTTGGGCTTGCTTGCTTGT
TCTCCCCCCCCCCCCTTTTTTTTCCTCTTTGCTGGGATAGAACCCAGGGCTTTTTGCTTG
CTTAGACTAGATAGATTACCCAGGATAATAGAGCATAATAGTGGCAAAATCTCTGTGGAG
CTTCTGGGGAAATAAGTTTGCTAAGCATGGTTTTTTGATCTGTAAAATGGAAATTATCAT
TTCACTTATGAGGATGAAATAAATACATGGAAGCATGATTAACTCGATGCTCGACATGGA
AAGCACTTAGTAAACAGCTTCATTTGAGGCAATGTCTTTGTAGTTGGTATTTTGTATATG
GGAATGAATGATGACAAAATGTTTCGGTCCCAGATGACACAAACTGATTATACCGTTACA
TTTATTTCTGACATTCCTCTAAGGTTTTATGATTGTGTTCCTGGAAAGTATTTGGGTTTT
AATTGTATTGGAATGGTTTTATGGGGGCGAAGAATAGGATTTTAAGGGGCTGTTCCTTTT
AGGTCTGCTTTTTTTTTTGTTTTTCTTGAGACTGTTCACTATGAAGTTCAGGCTGGCCTT
GAACTCCTTGGCAGCTCCTGGCCCAGCCCCCTAATGCTGAGATTAGAGGCCCCCCCCCCC
TTTTTTTTTGTCTTTTTCCGAGACAGGGTCTCGCTATGCTGTTCAGGCTGGCCTTGAGCT
CACTTTGTAGCCCAGGCTGGTCTTGAACTAGCAATGATCCTCCCACCACAGACCTCTGGG
ATTACAGGCGTGAGCCACCACACCCGGCTGATAATGTTCATTTTTTAAAACAAAGCGAAA
AAGAGAAGTCTGTTTCTGGCTCTAAGATGGCTGCTTTTAAATTGAGGCAACAATATGATC
ATTAGTTACAGATTTTCATTAGATCTTAGTTCTAAAATTAAATGTTGAANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCACTAATTTTGTCAGTAGGTAGATGTATAACCC
AGACTGTCTTTATGCTGATAATAGTTAGGCTTAATGAGGATTTCAGTGGGTTAGATGAAG
TTTAAGTATATAGATGTATTCTAAAGCTTTCCATCAGAAGAAAATCACTTGATGAGGGTG
ATGGTGTGACCCTGTCATCCTAGCTGCTTAGGAGGTGGAAGTGGGAGGGTCATAAATAAG
GTCATGGGCAACCCAGAGACATGACCTCAGGAAGGGCTGCAGTATAGCTATGTTTCCTGT
TCTGTTCATCCCCAGCACCCACCCAAAAAACACCCTGTCTCCTCATGTGTTGAGAACCAG
ACCTTTGTTCTTCAGACTTACTTAACCATCATTGTTTGCAGGATTCCAGACAGCATTGGG
AAAGACATAGAAAAGGCTTGCCAGTCTATTTATCCTCTTCATGATGTCTTTGTCAGAAAA
GTAAAAATGCTGAAGAAGCCTAAGTTTGAATGTAAGTGGCATACAGAATTCTTGAAAGAA
AAAATGATACAGGCTTTTAAGGATGAGTAATGGCTTGTTTTCATTCTGTTACTTGTATTG
AAGGTCACTGATTTAAGATGTACTTCACAACAGATTTGTTTTTTCTTTTCAGTGGGAAAA
CTCATGGAGCTTCATGGTGAAGGTAGTAGCTCTGGAAAAGCTACTGGAGATGAGACTGGA
GCTAAAGTTGAACGAGCTGATGGATATGAACCACCAGTCCAAGAGTCTGTTTAAAATCCA
GATTTTTAATAGTGATAAATAAAATCCTATTTGTGACAGCTTGCTTCTGAGCATTCTTAA
ATCTAATAGCTTGGTAAATTGGAATAACTGATTTGACTATAAGCTTGGGTGGGTGGCAAA
TTGTTTTGAGCTTTTTGGTTTGACAGTTGAGGTGAAAACCCACATATTTCTGTTACTGCA
TCATCTCTGCATGTTAGTGTTTTCTACGTTTGTCACATGATCTTGCTAGTATAGAGTTCA
GCTTATGTTGATCCTCCTGCCCCTTGCCTTCCAGGTGTTGGGATCACAGGGGTTTTGAAT
TTTTTTTTTTTTTTTTTTTTTTTACAGATTTTGATCTATTACATAGTTGTAAAGGCATCA
TGCCATTTTAAGGTGCTGGGATCTGGAAATGTTACATAAAGCACTCATGATGCTTCTTTA
GATACCTTTTTGGAGCCCAGTACTTGGTCTTGGTGTAGCAGAGGACATCAAGTGGCAGTG
TTTTTGTTTTTTTTGTTCTTGAGACAGTCTCAATGTGCACCCTAACCTGTCCTCAAACTC
ACAGCATCCTCCTGAGGACTGGGATTAGAGGCATGTACCACCACACCTGGTTTTTAAACC
ATTTGGAAGTCTTAATAAAAGTTTGTTGGCCCAGACATAGTGTCAGCACTGGAATTAAAT
CAATGCTTGAAGGTTTTATTTTAGAGAAAACAACTCATACATGCACTTTACTCAGAAAAA
ATACCACATGTAACATAGGTTTGGCACTACTATTGTAAGTTGAGGGCTGAAAATTGGATT
TCTCAGTTTTTAGGGAATATAGATGGCTAAGGGAAACACAAGCATTCCACCAAGAAACAA
AAATTATAACCTGAGTTTTAAAAAAGTGCAATACTTTTGTCTCTAGCAACTACAGAGTGC
CCAGATCCTTAGCATCTGCACTGTGCAGCTGAAGTTGGTTAGAGGTAACAGGCCTGTTGA
TGTGAACAATTTTGCTGGTCACTGTCTGGTATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1776..1879, 2233..2420, 4344..4552, 5621..5730, 5872..5993
1001..1062, 1776..1879, 2233..2420, 4344..4552, 5621..5730, 5872..5990
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved