Cavia_porcellus Locus CWF19L1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus CWF19L1
Cavia_porcellus
CWF19L1
GeneScaffold_7874
SNORA12
34615..34759
40579
gttttgttgatttaagagactagatatagagacagatgaaagtataaaaccagattgat
tcttcagtgaaaacaaaccctacatataaagtcaacttgggggaggacaactggagaact
taaaatatggatgtgtattaagcgacattattgaattaatgttaattttcttaggtgtta
acggtattgtggttatgaagaacgatgatgttactctaatatttttgttctggtactggg
gtttgaagccagagtcctgatcctaaattgtccaggcagggttcgaatttaggattctcc
tgtttcaactttctagagctgggattacagacacacaccagtgcaaacaggtattgacct
tattcttaaaagaatgattatgagttattactggtatctgcactttcaaaagactcaacg
aaaaaatgcttggggatcttgagagaagaagagcgtgcacaagtttgacaacgtgcagac
accgaatcaaggtgaagggcgttgctcttaaatatatgtaggtttaaaactttgttttta
aacaaagtgaatgaagtggatcaagcaagctcattaaaccaatatggttaggttaggttt
gggctgaacattgtaccgggaaattacttgtagatgacaaacttcaattggttagggtgg
tggtgggttgttgttttttgttttgttttttatcggaagtcgtactcacgatctcgctct
tgctaggcgcagtgacgctacgctttatcctcgtccattaggggtggtagtggtattctt
ttggtcattccctcttcctccctttaccccttaccgttcttgtttctgctcaaggcgaaa
ctttctataacatttctgtgcctcggcgctctccgtagatattggactcttattggctaa
ggtgcgcagaggtctttttgtagcgcagtggctttttcctgggagtgtgggctcgggttc
cggattgtaagtggttgccccagccgaggatactggaactaatggctcagaagcctctac
gcctgtaagtgaccctgaatcggaagtgcgtgtgcgcgcgtgcgctcgtgtaaagagagg
aggggtccaggggtcgccgaaaatgcttggaaactggtcaaatgttcgcttggctggagt
cggtctcttgcaagcagttttcgccttcgagcagggattttcggcaacactcactggaag
aggcgtaagcttccggaatcagggctcttttgtcttgtgccttcctggcctgtgacatca
tctccttttcatttctcctctcacaccatttattagccaaatgtttctacacttggagca
cgctgatgggcccttggctgtgagagaaacggtagagagtagctttgccctggcgcactt
gggatggggtgggggaggtaagtgaaggggaggatggcgaagagaacttcgttctttcag
caagtatttattgaataactgctgtgtgttaggtgcagtgctaggcgttgcacacatgga
gtttctgctccagtggagcttgtggtgtagaggaacaagtattaaccaaagaatatagat
aaacgataaaattacaaaagtgctacggtaacatggttgtgggaggatgtatagtagtag
tatttggcttaatggtaggaatcagaggaggtgtccttgaggaaatgaggtttaggccct
tttagatatttttgtctttaacgtagagaactcattaaaacgtttatactcctcgacatg
attagattttcgttttggaaagtgattctggctgcagtggggaaataattcagcaaagca
gaggacagttaggattagatagtgatggcagaggaaacatttaagaattgaaaatttact
aaatgaaatcagtaaggctgatttgattgagagtcagttgttactcatttatagatctct
ttcttcaggaggataggaaacactgaaaaggggcccaaattaaaaaatatatatgtatgt
ataagtgtgtatgtgtatgtgtggcactgggatcaaacccaggtcctcacgtatgctagg
caagcagtgcaccatggggctacatccttatcctgtagataataaattttgtggtgcctt
atgatgtacaaactggacactatatgtcccagaagtaattataattccatataacagtta
ctatggaagaagtttaggatcctgtgggagcatcaagaggtgtaactaaatagggactgg
atggttccctagaagactggtactcagaagataaaaagttttaacagtttatgacagaat
ttgttctgagattttgaaaagggagtgacttcctgaactggtcaagaaactgggccttga
aggatgggaaaaaaatttagaatcagagtggtaggatgggattactgggagagctaatat
cttctagggaaggcagagatagagtgatcaaattgacggttttggaatgtttcagcatgg
tcacacactgatgattacatgttctagtatctagtggaaccacaacagtcttggtaaccg
aagtcattttccccctatacaagaacaaccagatcaaatagatctgtagttgctgcatgt
tttacttcatgtctaaatgctgcatgtcagtttggattgaatactgtgtttgtgtattta
tgttttgattcatagtaacttctcatcttatagaattgatttgcattgaagcaaactaaa
gaaatgaatggctgaaagagcaaaaaaaaaagttaaggaaatggtataagaagtaggaaa
atcatacagatcaatattaagagtctcatgctcaaccagtgagctagccagatgtcccat
aaatcagaattagaaaagctcagaaatgagatgataaatgatgtcacttaacaacttggg
gctagtttgccttaccaatcttgagtctttacatattacttcctgttccatattcatgtc
tcccattatagccctaaacttatcagattatcttccctaccctgattgcaaactttttga
gaatttaagagtcttcctcctgtttatattactcatatgttcttagcattgtacttggaa
tgttgcacttagcataatgtaagcgtcagtatgtgcgtgctgaatgaatgactgaaaccc
tttactaagatagaaacactggcaataaggagagaatgaatatgacaaatatttgggaaa
acagcttgatggaacttggtgactagatggagatttcggactcttggtgaccaacctatc
cgtaaaacttgggaatgagaagaagctggctcccttatgaaggaagtaaaaacctgaagt
tcagatacagttagttggaggtgttgatgagacagaccttcagtggagctactcagtgat
tagtaatagcttacatgtacaaaaccttgtagtcagagaatgatcacctatttacctaat
ccagaaaactagtacatgtataccaaatctggcagaccctcttggtttcctgaatcacca
taatgtttttccattgtttgcagcttggcttgtggagatgtggaaggaaagtttgatatt
ttgttcaatagagttcgagcaattcagaagaaaagtggaaactttgatgtaagacattcc
tttttactgaatttaattttattgatgtatgaaacatactaaaataaagttcaggctcct
ttgttcagcttttaattgaacacagactttccatttttgttagattcagtttctttcatg
tatataagaactctagctgtgaagtgttggaaaaaaagagaccaatttattgtgcagtat
accattttctttttgcatttggatcttgttgctttattattgtgtgaaaaaaggaaaaca
ggtctgtggggtttagaaagcatagatctacttcatgaatatggtgcaaattaaaccaaa
tatgcaaatgcttcacaaactaaagaattctcaaatgatgttatatagttgccaaccaga
ctgtgaacatctaggatacagaaaagtattccagatatggagataactttgtatttcata
gaaaggttctttaaagtcctatttctccatcactggatatatatttcaaggaaggaaagc
catgaaatggaagagtaatacatgaaatatttgctgagcccttaaattctgattttattg
gaaaattcattttcccgatttctttttccccttccccaacttgaatgtgacatgcagtga
aagaaaatacaataattcctagaatcagtaactgtcaaaagtgctgataaataatgcatt
gaaattctgcaaattgttgaagaataaaaacttgatttgagactattaagtaggataagt
agccgaatgttactactgataaatgcttttatatttaacaatctcatatgtctgtttaaa
aaactcattttagctgctgttgtgtgtaggaaatttctttggctgcaccccagatactga
atgggaggagtataagactggtgtcaaaaaaggtatagaaattatttttgttttacatat
gatttctgataaaatttcaagtgttccagttcttgctgggttgtttcccacatgttaatt
acttaaaactttctcttctgagctctgcattgagctagaaagaatccatatgcataatcc
atatgtttacattttgaattgagttcattttagttccaggaaaataattcttatttgatt
gacaggaacttaataaatgcaatcaatgtgtcctttcttttttctggtgttagtattttt
tttattaagctatgttggctctgtattttcattgaccatccaccttaagataccacttta
ctggtctagtggcatcatgtaatagtcaagccataagactgaatatagaatattgttagt
gttaagaatgttccacatttaggattgctgtgagggaattcatagactatttttactatg
agcactttttatacagggaagaatttctcatattccaaaacagatctataactacatggt
gttgtgtctgtttccttcactagctcctattcagacatatgtgctcggtgccaataatca
ggagacagtaaaatatttcaaagatgttgatgggtgtgaattagcagaaaatattactta
tctgggtaagtttttacttttccgtttataatgaatgtaatacagagtttttaagaatta
atctactaggaaattttcctgagatagattcttctaccattactgcctgagagaatggga
ttgggggaattcttgcccaccatctgcctgttcctttaggacagtggcattttcattttt
ggtctcccccacttccgttcattctcccttgtgttcctataactcagtctacactttcaa
ccaactggaggaataaactctgagcctccattgtatggagttctgaagtatggttatgtt
caataaggaattacatctgtgtggccatatcagaaaccttgctggatacctgcagcctac
ctgttaggttgctaactagcttagctctaagttttattgtcagattttggcaactcaagt
tttgggggctggtccttgggagtttttttccctttgttaaatttcagatctgctcttcaa
ttccaggatatagtcattgcctgtataatgcttgtaatacttttagtggttctttcaata
tctagtcatttcaaattctgcttttgttttactctgctttagtttactgtctcttggatc
attcaactcatttttttcctaaaatgattccattgtgttttgtattctgttttcttgtct
tatttctctaaaaagcatctgtattttctttgctataaatgccctctttttctctctcta
tcatactccattctcctttagtctgtatcatgctatggtcatcatgtgagcagtcttgtc
ttgttccagtcaagtgggattcagcaagaaaactgaagagaggcttttaatgtatttttt
cttttttgcttttttttttaaaattttatttaaagaaagactaaacaaaacaggaaaagg
gtacaaataatacatacctttaaagaaaaaataaacagtaagaaatcactagttgatgtt
tacatactgtcctcttacaaatagttgttcaagatacaaaagtgaagcatacaaagtggg
gattaaaacagcgagactgcaaacagttgtgttcaactatccaacaaaaacttagtaaca
tggttgtcaatcctatacacttaaacatacatgcagttatccatatattcatttatgtta
acattaaacaaaccaaagcaggctaaaatcactctgaacaaagaataatagtattgctgg
atttcacatcattacactacaggatcagccctgggtactgcagtgtctctttttcttcaa
agtagttgttcatttcatcatgcgttataagatcacttctcataaactgttttttggttt
tttgtttgtttgatttttttttgtttgtgtatgttgctggggtctaatccagagcttcgc
atatgttctttcatacgctgcatcactagcgtctgtgttttttttttcaaaccacaattg
taaaatttacattttgaaatccttttgttgagcagacattgttgcacgtacctgtactct
caggtactggagaaattgtggcaggaagatcacaagattgaaaactgcttggtcaattta
gtgaggtcttgcctcaaaataaaataattttaaaagggttgggagtgtagctcagtgctt
tgttccctggggtcaagccccagtcctccaaaataagtaagcagataaaaatcatctgtt
gtagatgttaagatgggtgtgacttacagcaattgtcagtgtaatttttagatttgaata
tttgctatttgataagtcattttgccagcttaatagtacctgagtatttctgtgaattaa
attttttttagattcaatagaaggtacaaacaataatttttttctttgatattggggatt
aaatgcagggcattatacatgttagggtagtattgtaccaccgagcgatattcccagctt
tgcagacagtggtcttgatggtcaacctatgatgctgagcttgaagtgctggcagaacac
ctaacatgtagttagaagtcatggttctttatagagtatgtaaactaattaaaactaaag
agtacagactactcttcagaaattggaaactgtaaagaagaaagtttctttgggttcact
taacacatactaaatgagttagaagccgagcatattctgttgctcggttctgttgctcga
caaaaagaccctgttgagaagactcattgagggaaaagaaggaaaaagtctatagtgcaa
gtctgggaggcaatacaaaccaaggccacaagcctagaacataactttagaagagaatag
tgtctttaatttttcccaatttctcttccagaaatttccctcatatagcctttctgaaga
gtttatcttttttaaaaagtatgtcttttatactagagagtcctcagagctgtaattatt
ttttcttcttactgtctcttcctgtttctagattgctgtgtctagattgagtctagattg
cttttagactgagtgaagtctgctctaaaaggcaaaaaccctttttttcttaagcactgc
ttctcagcttttatcagtaatataaggtgcccagtgtagagactgcctcctcacggtggc
ttctcaggcttactgaacaggaatactgtagcagccaggaacactgatgcctggcagctc
ccgggttacagaaaagttaacactccttcaggcatgtagattgtcagggacctaggagag
tcctgagtatggggattcattgctgtgttgctaatgttctgcagttttgactaaaacttg
tctgtttttctttgaacccaggtcgtaaaggtaccttcactggaagctcgggtctgcaga
tcgtgtatctcagtgggacagagtccttaactgagccagtcccagactacagtttcagtg
cccaggatgtatcttccctgaaaacaatgctgtgttcaacatcccaatttaagggtgttg
atatcctgctcacatccccctggcccaagtatgtggggagctttgggaactcttctgtga
gtagtgcttgttcagttggaatttctgaaagtgaattgcattggcttgttgagcttttta
attttttaaagtttttctttttactctgtgtattttaccctttggtgccctcagtagaaa
tgttttgtgaatttttttgaggattcaaaaagctatataaactgaccaaagcaagaattg
atctcataaaaatatgattcaagatgagactgctggggctggatatttagctcagcggca
taagcgcctgccttgcaagtaggcagtcgtgagttcgatccctggtaccaataaaaagga
aaaagacaaaaaaaaaaaaaagatgagactgctgaactcttagttttttgttttatgttt
tatgttttaatgacttcctttaaatcaattgtctgcttcaggtacctcctctcaagcttc
tttgtattatattttgaggattcactaatttgcagttgaaaagacttaacagctgttgga
aactctgcaattgcattttccctttccattctagattattgctatcaaaatatttttaaa
agttgaatcatgggccagggatttagcttagtggcataagtgtctaccttgcaagtagtg
agtttgatccccagtaccaaaaaaaaaagttgaatcattatggtattgggtttagtaatg
taaaacattactaaacaaggtattgatgggaaacaaggtattgaaaacttttgtgtttct
ctgttaggaatactgtaattttagcatccactggagctaatcactttattggttttagta
ttcttataggtaattgtttgtttgtgacagtattatgctgtgtagtccaggctggccttg
agctcattgtgtagccaaggctggcctcagactcatgcggtcctcttgcttcagcctctt
gagtgctgggattgcagatgggcaccaccaaacccagtcagtagtcttgagaaagatgta
taccaggagtgataactgtcatgaggactgaaatacgttgtttaacatgaccctaaggaa
gttcttgtgtgggcacagggtgtagctcagtacaagagtacttgcccagcatatgtgggg
ccttgactttgatctccagcatttaaaaagagaagattgtgtggtttggggacaggaagt
atcagttgagccttacttgggggaaatataagaagacatgtagtgctaagcataatggtg
cacacctgtaatcctagcacttggaaatctaggataggaagattgccatgaatttgaggc
cagcttgaacctcttagcaagttcctgtctttaaaaaaatgcatctggggttaggacccc
ttggatagctttagtaatgttccagaagagggccctgtaggccattctctgccaaattct
cacaacatggttatgatcagaaaggccaacaagatatcaacattgtcaggaaggatatta
aaaggaaaagagacaaatcactcttctaccaacttttgactgctttttacctgggatgcg
aagggcagtgctgttacatcagatactgcaaacctaaggaatagccagagaaagactgtt
aaagtgacagacagtgaagggagaaggcatagatgatgtgctcttaaggaagaataaaga
ggtgaagccctttcattctgggggaagctaagacagggtattaattaaagtttataacta
atcatgagatacttatggggtagaaaataagatggtatacaggcccataagatactgcaa
ccaacttcaaagcaattccctacccctcagaataaacctgaagggtccaaagaaaaaggg
aagtcccgttttacttagtggaaaataagcacttatttccacttaataccttcttttaga
ataaataacatgatttattctaaataaacagatgagagacagcataattgttatcacaag
ctaggaatattcttctaataggtctagcttttgaaaaatgttactcattagctttttaaa
caaggatgtgattgtaccctttcaaaatcaccctttattgtgtaagtccacagagaccct
agagggagtggggatgaaaggggacaagcaatgcaaagagtggagacaagtcttaagtcc
aatcaagtcttgtttattcaaggaaaataacaaaaaagcaagtactcttatactgagcta
caccctgtgcccacacaagtatgggggattggggaaggggctgggttctgacacatcagc
aggtaactttgaaacagcgggaagttctaatgaggttgggggctatcggttaatttgagt
ctcttgtgtgaggtcccataaatcaggctaattagcatgttcgctgtccgggccgaacca
cagggagatgtgacaggctaggtgagaaagatagaaacttaactactaaatagaaactta
acattaagatgcctgttgtctttttaacataagatgatggccaattgcaggttttcccac
agggacgtagcctagatccccaatctccaaaatgagtgtaaggcaaaagattaaataaat
gagttaagtgatgtacagtgaaggcttaaatgaatgagataagtggtatgattttagggc
tccaggaggatcaaaaccctctatatagtttaaaggactttggtggctaagacaggggat
gcctctgcgaagtttatatttattgtttttttcaaacaacacaggaaactaaacagacct
tgggagtggttcaaggacttcgcaagcaccaaattatgttaacaaggagaaagaagatca
tgttgcatttcactgcaggggtgaaatgcctgtggctaccgttgtaatttaattagagtt
ggacccaggtgtcctccctcagtggttatcttatcttgccttggaccatgcagctgccct
gcatgtgtttccagtttcacctgctcccagcacaccttgacttaagcaaaataaaagact
atgcttttgtgacaaggtccttgaatattctatggatactaggtgctctgaaggctagct
tttacttttattttatgcaatgactatgatgactacattgttaatctcccaggtgcacca
caagtacagtgtacaggagacgcagtttgtgggctgtttaccaaaaaaggttttaataaa
ctgttgtgaatgttaatatggaggagttaactttacctggcttccagtaataggtcttat
ttctgtttaagtagtgtgataccgttaggagtcttcttttcctgactgccctgtgaaatt
tactgtgcagctcttactgcccacatttgtgtccatgtaaaaatcttagacatttcagac
atatctgaaattttgctgcatttttttgataatttccaagtctgagaatgactaaatttc
tgtttgctagggagaagtggataccaaaacatgtggttctgctttggtctccagtcttgc
cgtgggcttgaaaccaagataccatttttctgctttggaaaagtcatattatgagagact
tccatatcggtgagtagtatttattccttgggtttttgaagaatttctcatgaatttgct
acacaaatttatgtttttcatttttagccttataacatcttgattctttttggttgctcg
ggtacaaaaatgaataactaactcttaagccatcttctcttaggttatctcctaacttga
aacaaacgggattggatcataatgcccataagcacttaagaagtgttgactgttgaagta
acaatactgtataaacataactttttgtactatactaggtcctgttttcatcaggtcaag
ctgtagtcgtgaaaattacacttttagtgtaatcaccagaaatattcactttgtgaatta
agaatttctacacttgtatcagttcctttttattactttgattaaatagtttcttgaatt
acaaacaccagtgtagaatgctttttcttttttttttttttttgaggaggggcagtgtta
ggaatgaaatccagggctttgcatgtgccaggcaggtgctctaccatggagctacactcc
cactcagctctgttaaaagaaaagctcacaaagtattttgtcatatagtgtccaatattt
tttctgtgacatgtagacactcagatatttttgtattttttcctagaaagaaaaaatcat
actgtatatgtcttagtaggtgaggcctgtttttttcactttgaacacatttctttttgt
gttttgttttgttttgtttttgtatgtttttgttattggtgatactggggattgaaccca
tggcctctgcactaaaccacatccccagctcttttattttttattttgtgacattatctt
gctgcattgctcaattgcccaggctggcctcagactgctcatcctgctgccttaagctcc
cagagtggtggcttcacaggtatgtgctaccacatcaggcttattttagctttttattac
acaaaaggagaaaaatagcaaaacgaactctcatgtctctattacctagcttcagcgatc
attcatttaaactcttaaaaccagctgggcatggtggcgcacaactgtaatcccagctac
ttaagaaactgaggcaggagggttgtaagttaaaggccagcctggacaacttagtgagaa
catatctcaaaacaaaaaatcagggaaggcaggaaggcaggctaggatgtagcttagtgg
taaaacacttggctagcatgcagtaggcctaggctcaattcccagtactgtgaaaacaaa
tcaaacaatatgtacacatacaccaagttgccatttttggtgctttttagatacagtctt
atttcttccaaacagcctagtgaagcagggattattatcctactagatgaataggttgat
tctcctatgtggaaagatagtttctctgagatcaaatgactttgatagcagacttaagac
ctctgttcttggctcaatgaagtctaactatttcagtattgcaaatgaaaaataaagtgc
tggtaaaatctattaatctctcaaatgtgttccagaaaccatgttgttctacaagaaaat
gcacagcatgttactcgttttatagctctggcaaatgttggaaacccagaaaagaaaaag
gtaaagaattgaatgtgtggtggtaggttaatattatttttttgcctttttttttttttt
ctcagtttagcatgcaactttttcatttaccccagctgaaaggtcccagatgcttcaatg
actcctttgtaaagttagggttgtgaaaggtcatgtttccttaggtactttgtaggagat
cttagctaagggatgggaaagtgaattcagtggaataaagatagtatatcaaataaatga
tgttcttttctttctatatctatatggttgtctctataggtatttgtatgtttaccttca
gatatactctttgcttgcttcttttggcagttgcatttagctgaaataataaaactcttc
catgaatttacccaggactgcttaggcttaaggaaatattagtgattcctagaatctgtg
tttatattggaaaatagtaaagaaagagtaatctcgaaaaataggtgtatttctctttcc
ttaagagcttttttatgagtattcatatccatatatggacttgaagcccagtatatatcc
ccagccatatattttatttttatttttgggacaaggtcccactaatttgcctgggcttga
ctctacttgcaatcatcctgcctcagcctgttagagcttggggattataggcattcttcc
ccatgtgtggattaattttctgacttcctaggacccaaaacaacatttttggacagagac
agctaaaatccagataatgttcagacgggaaaatagccagaacaatctacctaaataatc
tgaagattattccactgtaatgtgccatagactatgtgcacacaaaagataataggtaca
tatttcagtttttccacattttaaacttttaagccagattttgtcttaatgagtttaggt
gtgtaattttttaaaatgccctttcaaatgaataacagaggactgagaatataattcagt
ggtagagcagttgcataggtcctagatttgatcctccagtgtgcacatgcacatacatac
atacacacacacagaaaattgaaaactacagtattttcagactataggttcattttcaga
catattaaacagtttatacttcaaaggttctgcatattttttaatttgacaagtgtattg
atctcaaaaattgttcgatctgtaatttgattagcagtgcaaggtttatttgcctatgtc
tttttccacacttttattaaagttcatgcccatctcatagctggaagctaatgtatcatt
atttattagtttcacttcctgattgcagtgaggttaaacatctatttataacttttgtaa
aaacagtattaggaattgaaccccattgccacttaaccccagaccttttttactttactt
taagacagggtcttgctttgttccttaagctagtcttgaacttgtggttctcctgcctca
acctctcaagtaggtgggattacaggcatacaccaccacactcagctttattcatgtttt
atgtaaagttttcaatctcttagtttaagattccagatattgagtctgggggaactctct
ttgtcgcctggggaccagtgcgcagtttcctgccgggactagcgagtggggcctaggcat
ggaatcctgctccagtctgggggaactctcttcgtcgcttggggaccagcccacggtttc
cagccaggaccagtgagtggggcagaggcacggaatcccgccccagtctgggggagctct
cttgctcacctgggggccaggctgaggttccctgccagagtggaacccagtcccagtctg
ggggaactctctccctcacttggaacaacacttgaaactcgaaaatataggaaaatgata
aaacgaaagaccacaatgcaacatcaaacatccagcccatcccaagaaagcctaggaacc
acgtacatagaagaaaacacatgccacatacctgaaatacctgaaataatagtaactgaa
ataaagaagcaactctggaaagccttaaaggaattcagattagaaataatcactcaggta
aaagaagaaatgataaaagaaatgaaggagatgctgaacatatctaaagaagacacaatt
aaaaaattgggggacctaaacaaaaagatagaatccctgggtgaacaatatgagaaacaa
acacaatacataaagcagatagaaagagatatacaggaaatcaaaaactccattgaaagt
tgtaaaaaccgcctcaatgaatgtgaagatagaatctcagacctcaaagacaagattgca
gccagtgaacaggaaaggaaagatcttttaaaaataacaagaaatcaggaaataacaatt
caacacctgcaagataacgcaaaacagaacaacataaggttgatagggataaataaaaag
gaaggggacaacataaaggatatcaagaggatattgatatcaacataaacgatatcaata
tttagagaagtaatagctgaaaatttcccaaacatgagattggaaactgatatcaagatc
aatgagccatatagaactccaaatagccataaccaaaataaatctacacctagacatata
ataatgaccatcctagaaatcgaacaaaagtatagaatattaaaagctgtcagagagaaa
agacagatgacctataaagaaaaacctatcagaatcacagcagacttctcacacaaacaa
taaagtcaaggagagcatggagtgaagtattctagatcctaaaggaaaatgatttccaac
ctaggctgatgtaccctgcaaaactgtccttcaaaatcaatggagaaataagatacttcc
atgacaaagaacagctgaaaaactacatgatcactaagtcacccctgcaaagaatactga
aagacagcctagatacctttaggaaaaaaccactaaacaaagcagacaattaaacataac
agaaagataaagatgcaacagcaggaagataacgtgtcaacaataaaccaatatataaca
gttataaccattaatgtaaatggtttcaatgcaccaattaaaagaaacagactggcagaa
tggatcacgaaacaaaatccaaccatatgttgtctacaagaaactcatctaacccaaaag
gatactcacagactaaaagtcaaaggatggaaaacaatacttcatgcaacaggaaccccc
cccccaaaaaaaaagcaggggtagctattctgtttgcagacaatctgaattttaagccag
taatgatcagaagggataaagaaggtcactacatactggttagaggaaaactgcaagagg
aagagataactatcttaaatatatatgcacaaactctagagcgccaagttatataaaaca
agtactaacagaaatgaaaaaccaaattagcagtaacaattctaacaggagatcttaaca
caccattgacaccagtggacagatcaaccagacagaaagcaaaaaaataaaagaactgaa
ttgcacctgtgaacaaatggacttaatagacatatacagagtataccacccaacaacaac
agaatataccttctcagcagtacatgggtcattctctaatatagaccatatattcataga
aaatatataaataaatgcaaaagggtcaaaattatcccttgcatgttatcagactatagc
gctataaaattagaaattaatgataaaagatactgcaaaaatcctacaaacacatggaaa
ctgaataacattcttgagtaatcagtgggtcacagaggaaaaattaaagaagaaattaaa
acctacaacaaatgaaaacacaaatacaacttaccagaatctgtgggatgcaatgaaagc
tgacctcagaggaaaatttatagcactgagttcccacattaggaaaacagaacaaataca
aataacctgatgttatacctcagacatctagaaaaagaagagcaagtcaagcccaaagcc
aaaagaagaaaagaaattgtaaaaatcagcataaatcaatgcaatagagacccaaaaaaa
tccaaaaaatcaacaaatcaaagagctggttctttgaaagaataaataaaatcaataagc
ccctagccaaccgtattttaaaaagggaagaaaaagctcaaattcatgcaataaggaatg
aaagaggtgaaattactacagaccctatagaaatacagatcatcaacacctatttcgaaa
acctctgctctcaaaggtttgataacagaggaagtagattcctagaagcatacgaggtac
caaagctaggtcctgaagatgtaaaactactgaataacccaatttctataaatgaaatta
aatccttacctacaaagatgagcccaggcccaggcggattccctgcggaattctacaaga
atacaaagaagacctaatgccgacactcctcaaactattcagtgaaattgaaagggaagc
aatccttcctaaatcgttcctagaagcaaacattacgctagtacaaaaccagagaaggac
ccaactgaaaaagagaagtacagaccaatctccctaatgaacacagatgcaaaaatcctt
aataaaatactggcaagtaggatgcagcaaatcatcaagaagattatacaccatgaccac
gtgggattcatcccaggcatgcaggggtggttcaacatacgtaaatcagtaaatgtaatc
caccatatcaataaagccaaaagtaagaatcacatgatcatttctatagatgcagaaaaa
gccttctataaggtccaacattcattcatgataagaaccttacagaaaattggaataggt
ggtctttacctcaatataattaaggccatctatgacagaccaacagccaatatcatacta
aatggccaaaaattgaaggcctttactttaaaatcaggcacaagacaaggatgtccctta
tcaccgctcctatttaatatagtactggaaatactggtcagagcaattagacaagagaga
gaaataaaaggggtaaagataggaaaagaagaagttaaattatcattatttgcagatgac
atggtactctacatggaagatacacaaaactccattgaaagactcctacatataataaat
aaattcagtaatgtagctggatacaaaatccatactcaaaaatcaatagcattcctatac
actaacaacaaagtcacagagggagaaatagaggccacatctttaacactagcaaccaaa
aaatgaaatattttggaattactctcacgaaagaagtgaaagacctatacagggaaaatt
ataacacactgaaaaatgaaattgaagatgatctcagaaaatggaaagacatcccttgct
catggataggaagaataaatattgtgaaaatggccattctcccaaaacttctatacagat
tcaatgcaatcccgttaaaaataccatcaacatacctaatagaacttgagaaatcactcc
taaaattcatctggagcgagaagagacctagaatagcaaggacagttctaagcagtaaag
gcaaggcaggaggtatcacaatcccagacttgaagttatactacaaagcaacagtagtaa
aatcaacatggtactggaaccaaaacagccaaacatcagtggaatagattagaagataca
accacaagtacaaacacactcaaccaccttatctttgataaaggggccaacatgttcact
ggaagaacgacagtctcttaaataaatggtgttggaaaaactggctctccataggccgaa
aactaatagacccgtgcctatcaccatgtactaaaataaaatctaaatggatcaaagatc
taaatattaaaacagaaacagtaaatctattggaagataaattggctaaaaaccttgaag
acataggagtaggtaaagaattcatgaacaggactcaaactgcacgggaaatacttccca
gagtcaataactgggatcgcctcttattaaaaagtttctgcacgttaaaagaaattccag
catagtgaaaagaaaacccacacactgggaacaaatcttagtgaactggccctcagacaa
aggacttctgtctaaaacatataaagaattaaaaaaaaatcagacccccaaaattcagag
acccaacccaaaaatgggcatctgagatgaataaacaattttcagaagaagaaatacaaa
tggcaaataaatacatgaaaaagtgttcgccgtcactggtcattagagaaatgcaaatta
aaaccacactgagatttcatctcactcctgaaagaatggccaagatcaagaaaaccaaca
acaacaaacgctggagaggctgtggggataaaggaactctcctgcactgttggtgggaat
gtagactagtgcaaccattgtggaggtcagtctggagatgggactggaaacaccatttga
cccagctattctacttctaggcatattcccagaagaactgaaagcatcataccacagtca
tataagtgcacccatgtttatagcagcacaatttgtaatatccagatcttggaaacaaac
taagtgtccatcaactgaggaatggataaaaaagttgtatttttatacaatggagtacta
ctcagcaataaagtgatcacattgagatatttataaataaatggacacagcttgagacca
tactcataagtgaaataaatcaaactcacatgtataaataccgaatagtttccctagtgt
aagaaatgataagaatacataaaattatgtggtaatcacgattctcaatcatactggttt
gaattcatttactgttatccctcattaattgcaatagttttaacctgggttgttcgattt
agtatcgttgatagtacgaatagatattctgaagaaaacaatacatcataaaagctagtg
ctgattcattatcatcttgttttgaagtcccgtcaagcttttgtacatctgtttccacta
cttttaacatgtggtatcttactatattttactacatgcgatagtataaacaaaattttt
tataggcaaagaggtaatatagaaaccgttgtttgttttctgttaactggttctaaatac
cctgtaacttcttcattctcttgaatggcttcagactgtcttgatatgcttgatgctata
gtatatgaagttatactcaaataattcaaggaaggaggtattatggtgactactattatg
ttagattatctgggggtgaaacaatgatccttaaattgttcggttctgtgttgttctaat
acagtgtcctcttttatctcaagctctacccttttttaaattaatctttttttcttaaat
ttttttcaattaaggggcaactaaatttaaaaatagtgggatatattatagtaacttttt
tgttctcctgttaactagatatgaactccagtattgctctccccatcttgttctgtcaga
ttttactatattctattttgtttgatagtatcaagtttgagggtataggcaaccactttg
aaggcaataagattctctatgatgcccattatggtttgactattatgttcttttgaaatt
ctgtaaggtctccagtgtaggttttatttgtcttgttctgtactgtttttatcaatttta
tgatacttgatgatataggcaactttttttaaaaatagcaagaggcacaatggtacccat
ttttgatcacgtgatgttctatttttgcatcatgtactatgcccatccttctgttctaac
caactctgttttgtttagtcacgttaggttttatttttttcaaaaaaagtaataagaact
gtgggagtaaaaaaaaccccaaaagtgtaattgttattaaaaagagaggaaaggaaggtg
gtgtaagggatataactgcatgtatgtttgagtgtgtagcatggaaatccatattactga
gcttttgttggatcattgatcagcactgtctgcagtctcattgtatgaatgtacaacttt
atatgctttaattttataatttggacaactgtttctaagatgacaatatgtaacctatta
tctcgtgatatcttactgggttttttttttcttgaaattctgtatcatttgtacccttta
ttgctttgtttttttatttcactttgttttttttatctttttcgtttttatcggtaccgg
ggatcgaactcacgaccacctgcttgcaaggcaggcgcttatgccgctgagctaaatccc
cagcccttgttttttttatttccttcctttttttctctttaaaaaaaaaaaaaatccaga
tatttatatttaccttttggcataagaaaatttcatcaccatatttaccagaattcatat
aataccagagaggaaaactcttaagttatccaatggtaattgtcattagaaaaaaagaat
agtaatgccataattctgttacatttacagaagggtcagacagaaatagttcattttcag
gtgttaaagagcaagtctctgggctttgtagtgacactattccctggagcaaatgaggat
gcctgatttatgtaagggctagggctttgatttattcctcgtcagttggtaaacccctac
aaaaactacagaattagcatttggctcaccgctatgtattctacaagttacaaaccggct
tttaatttattgaatttcagatcttgtcagtgaaattgtcacagtaaagtaagtttatca
catttggataaataaataaattcctctaatgttatgttctttttgtttaaagtatcttta
tgcgttcagcattactccaatgaaattaatgaatgcagcagaactagtaaaacagcctcc
agatgtcactgaaaacccttatagaaaatctgggaaggaaggatccataggaaagcaaat
tcttgctcctgaggtatgttttgattaaggatggagttttgagggcagggttgctcttgc
aggtgtacttttcctggtaatatcttagtatataaaacacatttaatgcttagaatcaaa
atcttgtttttctttctgaaattatgatagtatttagaaagtcttcatagatttaaacta
agttccatgttttttgttctaatttgggattgtttcataagtctttagttaaccataatt
tgtatattggtgttatagtttcatatgttaactttttctttgtctaaattgattattctt
aactcttaactattgtaatacaataaaataatagaataataaaaatcatgattgtattat
gatttataataaaattaatttttctccctccaaagcaaagaatgtcaggtttccttacta
ggatacatgatctgccttctcagacctgtcttctcaaaaagacatttttgtcttctcagt
tacttttattcctaatgattcatcttatgtctttaagttgaattactgtgaaactacctc
ttgtccctagtgagaacgtcaaaggaaattttttaggttcacactgattctatgtaagaa
ttactttgtaccttgcattttaactcacttttccaaagtgatgaatttggtggtagcttg
gataaatatgctgagatacacaactgacattctaggtatcaggtttgggaggatatttct
cattcatagaataggcagtaagggctgagagaacaggaatgacctggcaggaatgtttcc
ctgtatgtaaatggttgtctgcttgtctaaaggttaaatgaataatacactcttctccct
tttgccatccaggaacaatcaacttgtcagtttttctttgatttaaatgaaaagaaagga
agaaaacgttcatccacgggcagagacagtaaagcgtctccttacccaaagcagcctcgg
aaacctcgtaagtatcttggttccagtggtcttgatagtgaataataactgctattgtag
ttttgtttggcaaatagcattgctaagaaggcatcttctggcataggaaaattgtacaga
atcgttagagacaaaaataatgtaaaaatggcctgactgagactatgtggggctttttct
ctaaaaactatagaaaaagcttctttcctttgtgttgtaaaatatgataaattaacatac
aagaccgacataggttcataaaataataaaataatcaaactgaaaggtttttcattcctg
tctccatcctcctatttcaaagattaaggatatgaccttaggagagtaaactgtttaccc
agggtcctgtggctagttaatgggatagctggggctagaattagagtgcagtggaagttc
actgttctttcactgcagcctatggcaagttacatacaatttggaatcattaccagattc
caaattgtatgtccaaggatgttcccaaagcagactcttgaggaactttgactcctgtca
ctcattggacaggttgcaggttctcaggcttcatgccggaaaaagagttttcagcataga
tcagtaagagacatagggattctctaggcagaattttaaaagtcccacagtcaaagaaat
agagggattgaagcaccttgtagctttgagctaagtgtatttatgggaatttggatgtgt
ctctaaaatagattttctaggacaatgatggtgaccttttagagcttttggtgataatga
acagctggctacagtacaggtgccaggggttcaccatcactgatgtaggatatatattcc
cgtttttgtcaggttttacctatttgatgagctgtgtaaaaatgcacaccatttacagta
catgaaatacgctctcctttaactagtacacttcctgagtataagggttggtaggagagg
gttgtctttcaggctcttagtctttcagggaaaaggaaaaggcttgaataactttttttg
atactgggcattgaactcatgactgcacattgaataacttttatgtcttgaaactgcagt
gtttttaaaaagcacaatttgaggggctggggatttagctcagtggcataagcgcctgca
ttgcaagcaggcagtcgtgagtttgatccctggtaccgataaaaatgaaaaagacaaaaa
aaaaaaaaaagcacaatttgaatgtaattttctttgtctcatttctatctttattttttc
tgttctacctcaagatttgtgggtcactacctgcaattggttacagtttcagagcttttt
aattcaatggaaaaatcgtttttttccatggaaaatggtgtgtggatggagatcatgctg
aggaatacaagtctaacttcttgtggctgtacggcatacactctgcagtatataaagatc
agataaagctgagtttagagtgattatgtgttatagtgatcaggccgtactaacacttgg
ctttcttccacatgaagctcagcctccaggaccttgctggttttgccttgctagccctga
agtggaaaagcatttggtggtcaacattggcacacatgtaagttattataggaatctttt
ccagagaaggagattcctgtttatttttttattaatgttactgaggcatgatccacatat
aaaacttaaccattttgagtgtatacttcattgatttttagtagacttacacaactactt
tataacaaagttttagaacatttctgtcactccaatttctttttaccgtttatatttaat
ctctgtctctacccttagcacgaggtcctcactaggctttacatgtttgtgattttcaga
catttcacctaactgcaattatgaagtatatggtctttggcctctggcttcttttttttt
ttttttttttttaactttattcgtatttgcagtacataatgaatacattcatgcattcat
tataggaaattgatacaggtatatgacacaactcaattcttttttttcctttcccttcct
tccctatttttctcttttctttctttttgttatttttgccagaatgagatttatttattt
tataagactttgtcaggttgacatacacacaaggtaacaggtagaaaaaacataaaacag
acaaaacaattatactaaatcagggtacacttttagatacattgaccatggaggattata
gtaatttttttcatttttcttacctgtcttattttgtactttaattttatgtgttgaatt
tctcatataaaagaaactatgcagaatttaagcttgtgtgtctgatttactgacttaaaa
ttatgttctcaagatttaccaattttcctacagatgactcaagcatatccttcttcatgg
ctgagtagtactcattgtgtataaatacattttctttatgtgttcatctgttgatggaca
tataggcttgctttcaagatttagctgttatgaggtgtacttctataaacagatagtatg
tgtcactctaataagatctctttaactgtttggaggatatctagaaggggaatagcttga
ctaaatgtaatttctatttccagttttttgaggaatctccgtactgatttccatagtggc
tgtatcagttcacattcccatcagaatgaagaagggttgctttttcccctggagtctctc
cagtatttgctactatttgattttttgaagatagtcattctttctggagtgatacagaat
ttcagtattgttttcatttacatttctctaagggccagctatgtcttttgtatatttact
ggccatttctacttcctcatctgagaagtgtcattcatttcaaatgcccatgttttgatt
gggtctttgaactgaggaggtagggggttagttttcgcattctttgtgtaaagtcttttg
tctgagtagtagttaacaaaaattgtttcccatgctgtttcccattctcttcattctgtt
ggaaagcatcgactcttcaattcattgattctttgtattttttttggtctcaatttcatt
aatttctgttctaatttttataatatcctcttagctttggatttggatttggattgttct
tgtttttctgatgtgggaattatccaactataaacttccctctcaggactgcttttgtgc
cccataagttccagtatgtagtattggcattatcatttgattgtagtaattgcctaattt
cttccttaatttcatctgtgaccattaattattcaagagagattgcttaacttctgtgtt
tgcattatttctactttagtttccttgcactgtaatctgataatatgcacgggataattt
cgattctttaacatttatttaagcttgccttatgggatagtagctagtatgtggtctgtt
ttggagaaagttccatgtgctgctgaaaagaatgtgtattctgttgttagatggaacatt
ctttttggggggggtatatcacattgttatcttaggagtagttgttcaagttacaaaatc
aaagcataaaaaatgaatagacaaacaatgacagcacaagctattctgtttgacaaacta
acaaaaacttagtagtgtggttatctattacacacttatacatacagtaattgtgtatat
atacaagttgttttttccttttaagtactttctttccctttcattattgcaatatctatt
atacattttcgatcttattacttttagtttattattagtatttatttttacattagagac
aatatgatattgataaatgtgagtctaatttagatggaacattctgtagatacatattaa
gtccatttgtttgaagttttagttcaattctgataattctttttgactttctgtctagtt
tatccatggatttatgacagcagggcattaagatcccctatcacaattgtattggtactt
acctgacttttcatgcctattagtgtttggtttatgaaattgggaaattgtgtggaaatc
agtgttctctggaattaggatatctgtttctgtttatttctgggctcctattttgtgtaa
tgtcttttccatcttttgatttttaatcctttcttcttgaattaaaaacatttcttgtat
tctgcgtattgttaaactttgttgcttgatccattctaccaatctgtgtcttttgattga
aaaattaggacagtttgcattgagagttattactctgaggcagggatggtgaacctttta
gaatgctcagtgatacaaacagcctgctgtggcacatgtgccataggtttgccaccaatg
ctctaaggtattgatctgttcctttcattgcattattttcctttaactgatttctttact
gtttttttccccccttttcatttagctactcattctgccatgtgtattcattgtttttga
cttactggcattcttgacttcattgtctctttctagaatatccgtgagaatttttaagtg
atgctagtttggtggttatgaatttcttgaggtgctccttatttctccatcaggtttgaa
ggaaagttttgcagtatatataagtcaggattggaagttattaacttttagagcttgaaa
cacttcattccaagcatgtctggcttttaatttgtgttgagaagtctattgtaattctaa
tgagtttgcctttacatatgattctctgcctttgtttgacagcttttaagattttgtccc
tttgatagacttttggtactttgaatataatgtggaaccaaaaagttcccttttggttgt
ggctatttgaggttttatgttcctcatttatgtatttgtttttttttcctatgtttggga
cattttctgcagttatttttatgaacaattttggttgtttatttttttgtgtgtgccatt
tgtatttgctgttttttcacttaatccagttactcttagatttgatgactttgtgccatc
tagcagctgtttgatccatttttcctgttgacttgttgcttttaagatgtcattgagaag
ttagccttcgtggacatcattgtcttctagtgttgaagttttgtcctcacattggttgct
tctgctgtccgtacttcaactataatttgtaacctcttagatttctgtttgaaactttga
attctttgctaaactggttattcatgctttctacagttttatttagcttagctaggtttt
tattagtgttttctgaaaacttctggaccatgttggttattatttctgttatctgtttgt
ttttatcttctgtggtcccactgaggacctctttgatctgttttgtaacctcctcttaca
atatcaagtaatttgggtgcatggcttagttactttcccccatgatgcccaccatattgg
cttgggggcagttggtaattttgagagacgttttgttaccttgttttacgtttctgttgt
ttttttgtttgttttcttaatgaggtttgtggatgcttatagtataaaagacttccttgt
aagtgtagtgttctgttcagtatcttttcactgatgtactttagcattggctgttgctca
gttccaggctgatcaccctggttaatttttgagaagtacatacactgtaactggccaata
ccaagttctctaagaatgtgctgtagtatagttaatatcacaaaggtaatatgaatattg
tcttatagaaaaaaaatccattaatagcaaaaattatgtgaccccggtaataaccagatc
aactacagtagtattgtccaggacaaattagatgttaacataccataagaaccaattatg
tgccacccttcatgctagagaagaaatttacataatggtataaaaattaagacaattcaa
atgttgacttacagctgataggtactatatgagatagctataaggttgaaaatggaatgt
gagaggaaaaatttgaaactttatatgatacgaaaaagaggaaagagaagtgttacaaag
gttcttgttggagaatagaacaacttttatggaattaggtaaatgtaagagaaaaaactg
acagaagataagagaaaaagaagaagaatcaaagttagagaaaaaaattaaaggggcaaa
aagggagaggaggaaaaataaattaagaaaaaatgagtgaggctggggatttagctcagt
ggcataagcacctgccttgcaagcaggcggtcgtgagttcgatccccagtactgatttaa
aaaaaaaaaaaaatgagtaagaaaaagaataagagatgagtaaaaggccaaagaaaagtc
ctctacaccctaataattggtaaagaataaaggaggaaaagaagaataaaggaaaacaac
acatacacacagagagggaggtaaagaggaagaagaaatttctttgattttgaatacgtg
gcttccttctgggatctacgatttggaggcagtgtctaggtctagacatgttcctgctca
cattggtagataaggcagtcagacctcagatctgtgctggatgcaggcagtagcagtagg
gcaagggcaccagtactgtgactttcaaatctggagcaactcaggctgagcctgccctct
ggctgtgtggagagagcctgtgtcctttagctttgtcccctcaggcagtctctttcctgc
tggctccctgacttcagttgtttaccagggcagtggctcacccagttactgtgggaagta
acattgaaaaccctgaagctgtccaactgctgcttcaagttctggattcaaacagttaac
tctttcccagaatggaatccagcaagcactctacggatgtggagggcacttagactacag
cattggtggtgagcctatggctcatgtgctacagcaggcatacagagccctctctgttgg
cataggagtcaagttgccccagcagccaaacatcaggtaataaatgtttttttctaaacc
aaaaacacagtattcaggtttaattgcagtgttggtactttgcaataaacgaattttgag
ttgcagtttggcattgagtctctgaaagctacaccatcactggactagagtcactcatta
gctgtttcctattgaaggactcacgtggcagcagaatcacactctctgcagattgcagca
tctgcaaagccattccactagtgtttctccctgaagccctctggagtcccccatctttca
cagtctctgtttattcgatctccctttgctataaacagtgagcagtgaactaaggagaaa
gtctatactgtccttaccatactccatattgtgctttgtttcttgaatttctttgtaggt
tttaatttttaatttttaatccttctggtaccaaaggatctacttcttcttcttcttctt
ttttcttccccaagttgttcttttccagtgtctgaattctgaatctcaggccgagctgtc
gtcacttgctgctctgccattttcctggaagtctctgtgtctggcatctttagtattata
ttcttgagatatatctgtgtcatagtataaactgctatttcattcctttttactgtcaaa
taatattctttgtgtggatataacatattttgtctatgtacttatcacccaatccacatt
tgggttgtttctacttaatgactatttggaataatgcttccatgtaagatttgcatacaa
gcatttgtgcaaacatgttttcttttcttttggaaagataccaaagaatgaaatagttag
ataatacaactttcttaactttttaggaaactaccaaactttttcaaaaatagtggcact
attttatattgccatcagtaatatataaggatttctacatccttgccaacatttgttact
gttgtgttattttgtttagttttgtgggtgtatcctagggctttgcatatgctggagaag
tgtactaccactaacctacatccctagcccattgttagtcttggattatagcatttattc
tgtggtacttttgtagaatcagtttcacaaggtcactgactgcctttccttcttcgcact
cactcaaataggtgtgaatctcctagggtaaagcttttatatacttctcaacccctttgt
atttttagtccatactacttgcggctgttacttttcttgtgttaattgcttattacttaa
aatgtaagttttctttgtcctgagaaggaaaacttgtgttgcttgttctcatattgggtt
aatagtgttgatacgcagccagtcatgctggtacacatctagaatcccacctccctggaa
ggctgaagcaagaggactgttagtttgaggataacctgggtaattgaatgagatctcatt
tttttttaaaaaaagttgctattttctttatagctttagatttaggtttttatttttgat
gttgttgttttaatttttagatagggtcttggtaaggctgggctcaaacttgctgtcttt
ctgtctcagcctaccagagtgctgagattacatgcataaatcactatgcccagctcaggt
tcagaaatttgaacttaattttttaaaatacagaactaagtagtactgggagctgaatca
tactaatcatatgaaagactaaagtgacaggctgggaatttagcttagcagcactggcgc
ctgcttggcaagcttgagatcatgagtttgatccccagtaccaaaaaaaaaaaaagaaag
aaaagactaaagtgacaaatttctgttgggtaatagatgtagcttcctaatgataggaag
actcacatctccattcctggtggaagtatttggtaatcctcagataatgactataaagtt
gtttggttagaaaacactaaatcagactatgagatcttgagtataattttactcaggctg
agaaagccctgtgtcttacatgtgtcttacatgtgtcttacaggaaagtcattctatttc
acatagaacagtacctctagaagcttgtcaggcagggctcagttagacattaaataatta
tattctttgactcatgtttctccaggttctaaatagactattttcttttctttcagttag
aattaagaaaagttaatattcagggttatgagtatactctagtcacccagactagaacca
gatgtttgtatcgtttcttggccttttggctaagaacaagtgtagaaagatgttcaccaa
ggttcctgaggggaatatttacaaatgatttcttagggtataatgcttgtgcctactgct
ttcatctagttttcagtgatttttttgtaaatttggtttctgagggtgacctttcttcag
cttattccaacagtccaaaggtcttattttgtagcctcttatacattgactagaatttgt
tttttcactttgtttcaaactgagagtttcagtttttcacattagtttctaatgtctaat
gttggcagatttgtatctctggaagatactcctgggatcaagactggtgattttatatta
ttattgttgttattattttgacagtattagggatcaaacccaggaccttgattaactgag
ttaatcccagtcattttctctttcttacataggatctggttctatttccgaatatcacaa
aaagaaaaaagtgattgtaaaactaaagttttagtatctctgaggttctgatgaacttgt
cacctagtaaacgaactttacagattggcttagtccaaagaaagcgaggacgagggatga
tcacatttcagtttgtttctagtacataccttgtcattctgttggactttcttactgtcg
atgagaaatagatgatggcatccttcagccttatctttgaatctaccacattaaaagagt
actctacattggaatttttttctaaagcacatatgtttgattgcatggtatttgtttgtg
agcctttgctgctcactcacagtgtctttccttcgaagagtgtatgactggtaggataat
cctgcacattttatttttgacaaaaataaatttagttgctgtgaaagccttaatatttaa
gctgggtgtggtggttcacgcctgtaatcccagcattcacaggccgaggtaagaggatca
tagtgagtttgagaccaacttgagctacaaagtgagctcaagaccagcctgaactgagag
tgagattctgtctcaaaaaaagagaggagggctggggatttagctcagtggtttaagcgc
ctgcctggcaagtacgaggtcgtgagttcgatccccaataccaaaaaagaaaaacaaaat
tatttattatcgagaatgttaactctctaccttgttgggtaaatctgagtttaaaatttt
tctttcttccttccactcatttaggccgtatgtttcttcttattttatgaaactgttagc
agcttaaggctgtggggacattgggtgctaatcatgtcaccttaaccattccagggttta
tttagggacatatgagattggatgttattgggtaggcaaacaattttgaaatcagaagta
ctgttcttctgtggtcaaaaggaaagcaataataactgaaatgttgttttgttacttgca
tagaaacgttacatctgatctctttctttagaagatacttgggaacattattgctctaac
ctctaacatcagatttttaaaagtagaatttctgttaataaagtcttgaacattttttcc
agtatcctcactctcactctttctgtaagcttttctctgcagaaaactatatgtgcagta
ttgtgtcttgactctgtgtttctttgtcagtgctaccttgctctggccaaaggaggctta
tccgatgaccatgtcctcatcctgcccattggtcactaccagtcagtagtggagctttca
gcagaggtagtggaagaagtggaaaaatacaaggttaccctaagacgcttctttaagagt
cgagggaaacggtgtgttctgtttgagagaaattataggagtcatcacctccagctacag
gtaatgatctctgcccagaaacataagaggacaccatggtgaccttgatattgataaata
agtatttaagtagtggttacttggaatatttacatttaatctaatatttaaagtatttaa
tatgaattgtcctaataatatttaaatattatttaaaagtttaagagtatctggtgataa
ctctagagatttcacagggaactgcatggtcggtagaagtgaacatcagaatgttgactg
gtaaaaaaggagtgggtaattgagagatgttccaaggaagatgtaggccatgctaagtaa
cagtatgaaaagcaattttgcagtcacatgagtgaaggcttaaagatagaaaatagcatc
acagagggctcgggatttagctcagcagcataaacgcctgccttgcaagcacatagttgt
gaatttggtgctcggtacaaaaaaaaaaaaaaaaaaaaaaagctgggattttgctcaaca
tcgtaagtactggtctggcaagtgcgaggtcatgagttcgatccctggtccaaaaaaaga
aagaaaatactatcagaggccacatgagctagcagctcagaaatttggtgattgtggttg
tggtagtttctttctggcacatttgttaagttttcaaatgggtctgactctaccacatac
attgtaaggagctagcaaaagcttagagactgaaatatctctcttgagcttttttgtatg
agatattggctctcacaatcgatctcataagtttaagtcctacagacaggctgacaaaca
cctgcctggtctgaggagagtctgtactgagggctgcttttctacccctgtgatggattt
gctgcttttcaaaactatacagatataacctctctgggacctgtacaatgaatttttcct
attccccaacccctgtctaggtcattcctgtgccccttagctgctgtgctactgatgaca
taaaagatgccttcattacccaggcacaagagcaacagatagagctcttggaaatcccag
agcactctgacatcaagcaggtaaaacaggaatctggtgattttcaaaaaggaataaaag
atctagtgtttggtttagcccaagaaactgtcaaggaatttcaagaatgttaaacgggca
gtagacaatttggaaccagaccacagtatactgattaaactggagatggaaacagcatta
ctacaaagtcctagcatttttgtgggaagagcaagaaactagacatttcctaagatggga
attgaacaggagggtgccattgggaagatctgggaatatctgacaatctgactttttaaa
ctctagtactgcttaatagtttgagatctgtagctcatcatatatcattttcttacactt
ttaaaatgaattatttggggctggggatttagctcagcggcataagcgcctgccttgcaa
gcaggcagtcatgagttcgatccctggtaccgataaaaatgaaaaagacaaaaaaaaaaa
aaaaaaaagacattaaaatgaattatttgccaaatgagagcttttaagagatgagcaagg
attttaaatcttcaaagcactattatatgtcctgatacaactctgtttatttcagattgc
acagccaggaacagcatatttttatgtcgaacttgacacaggagagaaacttttccaccg
aattaaaagaaattttcctttgcagtttggaaggtttgtatgttttccttccttttagtg
tattttcagtagaactgttgtaaacaaagtgatgagtggcatgaacaattgataataagc
cagataggaaacatgcctcaccccaaggagtttataggatcaaggcaaatcagatcagcc
atgtgatacaaaatgtgaaatgtagcttgacagagttttgggaaacaatgtactttagaa
atttagaggtaatgccaacactcaagagactaaggcaggaagagcacctcaaatttgagg
tcttcttgggctacatagtgagttcaaggatggcaagaactgcagagtgggacctgtctc
aagaaaaataacaacaaaaaaagaattaagatgtgttatgtatgtgtacaaactcccatg
ataaatataatcaatatgtactgcaatcatgtactgatttaaaaaaaagcgtgaaatgaa
aactggagtaacggggctgggggtttagctcagtggcataagcgcctgccttgcaagcag
gcggtcgtgagttcgatccccggtaccgataaaaatgaaaaagacaaaaaaaaagaaaac
tggagtaagaagttaagaatgactgctaatgggtgtaagatttatttttggatagaaaaa
tggtctggaattcaacagtggaaaccagtgcacaaatttaaaaatataccataagtccca
actggtgaacatgttctgatttgggagaatgttggtaagtcagattcatttgtaagtttg
acaaagtgagtcttgcacacttttgatacagttattgtaagacataagaaaaccaaacac
acacacaaaaaaatactgtaagtaaactgtttttacctttaagcacagtgactatttatg
tttgccataggaatctatgtttaattatgagtgcttccccagactctgtcagggtttttt
ttttttaacatataacatattaaatggatctcaccacctttttgttgtttttttgtttgc
tttttgaggcagggtcttgctgtgcaatccaggctggtcttataaataaataaataatct
caaagcaggaagaatttatttctgcttgatgtaagggccttatgaaaagtcaaaaagtaa
atttaagacatagatttagagggcaagtgctggaaaaagcgcatctaaccagagggaata
aagtgttgccattgaccgtatgctgtcgatcatacactgctaagaactccgtgtgtattt
tctcatttaatcttcacaactgtgtaagacgggtattatcccagtttattaatgtagaca
gtgaggctctagagcaatgtctaacagagttttccacaaagatggaaatggtctacaaat
ctgcactatcaaatacagtaatgactggctacgtgtggcatttgaacatgtggctaagta
attgaagaagtgaatttttaattttatttaattttaattaattacactttgaatttaaat
agcacatctgcttaatggtactgttttggatagcatgggttaagaggggtaaagtagcat
acctatggtcacagactggcaggtttaaatccagatctgttggactccaaaataagataa
ttttattattctgcagtattctatcaggtaggctcatcgtattaggcagaacatgactgc
aagaccattcggagagcaataatacaaattaggcaaagaatgaagactggaggttacagg
aaaaaagagacagagtctaaaggggaggagaaaatgtgcggaatgcattatttcatggta
gtgtctgatttgcagctgttttttccccctagttagaattggactttaaatgaccccaga
actatttctgaactaacttgggaaacctctaaaaggttgccctattttctgcattttcag
ggagataactaataaatgagaagaatggggtattatgtttcaaacctctagcttgatctt
tttgttgttgccttaacacatagatagggacatgactaccaatgtatataggcataggtc
ttagttacttttctcattgctgagacaaaatacccgacacccagagttaaaaaaggaaag
gtttatttgactgacagttttaattcatagttggctgactgtaagacaatggcatggcag
agaggcatcacagaggaaagacagtttataacaagcagaaggcagcaagcaacaaggaat
gatcctctttctgtcccttatcttacccagctaccctccctgtgaatgggtagcactcac
atttttaatcctagcattacatgctttatcctagcgtcacacaccctagatccagccaca
tctgaaaagccccacctatgaccacgtgaggctttagatgaacatctagatacaaaccgt
aagggcatgtaaagctcacaaatgggagatcctttcaatgactttgtgttcatgaaatca
tttatatatatttttttttttttactggtaccagggattgagctcacgaccatcagtttg
caaggcaggtgcttatgctgctgagctaaatcctcagccccaatcatttatatttttcaa
gattaaatatttttaaaataatttaaagttactagcattttacacttaaaatacttgaaa
agccattgttttcctaactgtaaaaggaaagtgattctatcttcattttacatctaatga
aatagtctcaaagcatgcccaaggagctagtacttgggcttaggtctactatggctttta
gaggtcttagacagccggggatttagctcggtggcacaaagcctgcatcgcacgcctgag
atcctgagttcaattcctggtaccaaaaaaaaaggtgtggggggggagaaggtagaaatc
ttagatgatttctttctaatctatttattgtagcttcacagtagaaaatggaccaagtag
atgcatagactgatttgtagtatatcaaaataagtaaaaatgaataaaatataaaacagt
agaagaaatatatatatataatgttattcttttgttctgagagttacagtaagttatttt
cttcacattgagcttaggtacatgtgccagaaggaaaggcagagaattttaagccaggat
ggcttaaaatgggtatgagacccaggatgggtatgatacccaactttgctctcaacaaac
tcgtggtctaattaagatgacaaaactacagtctatggcaaaatgcaattcacagttagt
atagagttagtatagtcccttgtattatctctgtgcttcacaaaaccatacaaagtaagt
acctttattcaaattttgtaggtaaggaatccgagactcagagatgaaataatctgttcg
aggcatagatagcaagtgacagagcaaggaatggaatccagtcctgtgatctgacaccag
aactgaccttctggtcatatgccatgttgctgctctacatactgtaacagtaatgtagct
tcaggttgttcaagagaaggaagataaagtgaagggtcaggaaagaggtaggatctgagt
tggtcattcagtatgggcatgatttcagtagaatggcagagatggcactcagggcaggag
aaaagtataagcagtcttagaggtctgcatacttgctttgcgtggtgttgagaactctct
ggctggagtgggacaggaggagggcatttggagctaattccctccatttttgcttgtttg
tgctcttttctgcagggaagtgctggccagtgaagcaattcttaatattcctgagaagtc
tgactggaggcagtgtcagatcagcaaagaagaagaagagacacttgcttgccgctttcg
gaaggactttgaaccctttgacttcactctggatgactaagcaaaagggagactacttca
tgaactttgaaaaaaatttttccattgtgtttttaatgaaactgcagtctctcttgggaa
ttgtttccctgcctcattttcatgcatttccatggaacctacctgcagcaagaagcttag
gattgaaaatacacttttttttttaaggaaactcattctaggatgaaaattctatgctaa
aagcttgtctgtcaatcagcactaagaacagcttgtgtttatctacattttcaaaaacaa
attaccaaataaaatctaaatccttttcctttttttttttttttttttggtcttttgaga
cagggtcttttggccttgaattcggagcattcctcctgtcttagtctccagagtgctggg
attacaggcatgtgccactatagctggctccaaattgtttctaatagttgagaaatctct
tgtattcatgttgcctttgatcactgaaatgaagtagtgtgtgaaataagaaggaccaga
gctttcggcccaactcctttgccagaatcacacagggtagttactcagggaaatacccag
gttagagactgggccaatggtgtttgcttttttttcttacaccataatcatctcattcat
atgtaagagaccagtccttcagatatttatatactttgcatttttctaggctctaagaat
atagtcatgccttatcatggtgctttttttgtccaagagtttagtctaattagggataga
aggagaagatttaaggagttgtgctttcaataaattgttttagatgtcttaacagatgtg
tcatcagatgaaaatggcaaatattaatgtatcacagcagtatactgttaaataatccta
aactcatggagatctgggttggcgatagggctttagggatcatcagggtataggccataa
atgaacttaggaaaatgtatgaacataagagagggtgactcttttgtgcctcagtgatct
tgtccatgattttcctactt
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 3503..3587, 4393..4471, 5003..5104, 7881..8095, 11470..11588, 13115..13199, 21952..22092, 22932..23046, 24557..24636, 33810..34019, 34940..35059, 35635..35732, 39435..39579
1001..1023, 3503..3587, 4393..4471, 5003..5104, 7881..8095, 11470..11588, 13115..13199, 21952..22092, 22932..23046, 24557..24636, 33810..34019, 34940..35059, 35635..35732, 39435..39579
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved