Cavia_porcellus Locus RPL3
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPL3
Cavia_porcellus
RPL3
GeneScaffold_1182
SNORD43, snoU83B
1452..1515, 6411..6504
7271
AGTGAGAACCACGCTGCGCTCGGCCTCTACAGGCAGGACGAGACGACGAGATGGTATGT
GGTGTATGGCGTTTTTGCTCTTGTTCCTGGAACCGCCATGGCGGAATCAGTAGTTTATCG
TCGTCATCTCGGTTTGTCCTGCTCCAAAACCTTGATTAAGAAGTTCTGGGGACACAGCAG
AGTCAGTGATTAGGGCTATTTTCTAGAAACTCTCAAGGTCTACGGAGAAGGGTGCGTGGA
TTAGTTTGCGGCCTACAGGTCGGCCAGAGAAAGGCCTCGGGGTGGGAGCAGGCCTCGAGG
CTTTACATTTAATAAAACTGTCTTTCTCACCGGATTTAGTGATGAGGGCCCATGAATTCG
CCTCGTCACGCGGCTTTCAGTGGGCTTACTGGATGTTTAGGATGGCGGGGCAGGCGGAAA
GGGGAGATTGTGCTAGAATTGTGGACCCCGTGTTTTGAAATGCCTTGTTGCAAATCGTAA
GCCCCCTGCAATTCCCAGAAACCACAAATGATGAACTTATTGACGGGCGGACAGAGACTG
TGTGCTGATTGTCAAGTTCTGATTTGGCTCTGGGTTCTAGAGGCGCCTGTTGCTAGAACT
GCAGGGTTCTGTAGAAAATAACACCCGCCACCGATTGTCATCGGGGTCATTCTTCCGAGA
TTCACACATAAATAAAGCCATTTGTTAAGTGGTTTATTGCCAGTATCTGGTGCTGTTTTG
TGTTAGGGAAAATTACCTGGTTTATTTTCTTGTAAAACAGTTTCGTGTTCAGGTGTGGTG
TTAGGCCAGGCTGCTTTTCGGGATTCAACATTGATGAGAACACCTAAAACTACAGAAGCC
AGAGCTCAATTTGGTTATTTTCTTTCCCCCAGTCTCACAGGAAGTTCTCTGCTCCCAGGC
ATGGGTCTTTGGGCTTCTTGCCTCGGAAGCGCAGCAGCAGGCATCGAGGGAAGGTGAAGA
GCTTCCCTAAGGATGACCCTTCCAAGCCCATCCACCTCACAGCCTTTCTGGGCTACAAGG
CTGGCATGACCCACATTGTGAGGGAAGTTGATAGGCCAGGATCCAGTAAGTACACGTTGC
ATTGTCCTTAGGAGGATGGGAATGTTAAGCTTTAGGGCAGATTGGCCCTCCAAGGCTGCC
TGTAGAGCCCTAGAACCTGCTGTGAGTAAATGTACTGACAGCCACAATAGTGTTTAAAAA
AATAAAGTGCTTTGAGTTGCTGAGGCTGCAATAGAAACTGCCTTTCTGATAGGTTAACCT
CAGCAGAACACAGCATTGTCTACTGAGCAAGTTAGGCACTTAATGCTGTTCTGATCCGAA
ATGAACTGTGTGTGACACCCTGCCTGTTGAGAGTTTTAAGTGCAGGCTCACGCAGAATGG
GAGATTCACAAGGAGGGCAGTCCCCAGGGTGGCCCCACTTCTGTCAACTCTGAGTTGAAG
CAAATTGTTGGCCTGGCCTAAATGGAGATTTGACTATTTTCTGCAGAACTCCTTGTGGGC
ATTTTTTGCCAGCTCGCTCAAGTCTGACTACTTTCTCTGCAGAGGTGAATAAGAAGGAAG
TTGTAGAGGCCGTGACCATTGTGGAAACACCACCTATGGTGGTTGTAGGCATTGTGGGCT
ATGTGGAAACGCCCCGAGGCCTCCGGAGTTTCAAGACCGTCTTTGCAGAGCATATTAGTG
ATGAATGCAAAAGGCGCTTCTATAAGAACTGGTAGGTGGGGCTGGAGAACAGAGAGTGCC
CAAGGAGGGCTCAGTTCTAGATGGGAGGAGCTGCTCCGTTTCCCAGCTTAGTTGCCCTCT
AAACAGGCTAGCAACCTGGAGCAGCCAGCATCAGTGTGCAGACACTTGTCATGTGTGCAG
GCTAGCTAGTGGGTGTTGGTTAGCAGAGAACCCAGTCACCCTGGGTTGCTGGGAAGTCCT
GCATGGAGACAGCAGGTGTGGGATGATTGCACCACTGTGCTCATGGCAAGAGTGCGTGAC
CTTGGGTTGATAGCCCTTTTTCTGTGAGACTGCACCCACCCCCCAGATAGAAAAGGGAGC
TTTCTCTGGTATCATGGAGCGAGAATTGTGTTGTGAATGTTTGTGGCTTATATTAACCTT
GTGGCCCTCTGCTCAGCTCCGCTCAGCTTTGCCTGATGAGCTCCATCCAGGCTCCGCTTG
CCGGTGGAAAAGGCTCCTTAGAAGCCGGCAATGAGCCCCATCCCCACGTGGTGCCAGTGT
ACCTTCCGCTGCCCCCGCAGAGGGGTGATGAAGGCCTGCACCCGCCCCCTTTCCCAACTC
TGCTCTGCTCCTGAAGGCATAAATCTAAGAAGAAGGCCTTCACCAAGTACTGCAAGAAAT
GGCAGGATGACATGGGCAAGAAGCAGCTGGACAAGGACTTCAGCAGCATGAAGAAGTACT
GTCAGGTCATCCGCATTATCGCCCACACCCAGGTAAGGGCCTGGCGTCCTGCCTAGTGCT
GTGTGGGGTTCTCCTCTGCTGTGCAGGAACCAGAATCTTTTGGGAACTAAGGCTCACCTA
TATGGATGAACCAGCTAGGAACCTGACTGTGAGGTTGGAAGCTGCCTTGTGCCCTGGGGC
CCTGCACTGGATGAGCTTTTCCACCAGCAGAGTGTGCTGTGTACTCAGATTCTCTGAAAG
GGCAGCTGTAACCTACTTAACAAAGTGGAACTTGACCACCTGAAAGTCGGTCTGCAGTGG
GCACGTGCTGGCCAGCCACTGTCACTTGAGTCAGACTTGATAAGAGCTATTTTTCTGTCC
CTGTCCTGGCTGCGCATCCCTGGTTGCAGGGGTTCACTGGCTGTGTGTTGAGGGACAGAT
CCTGTAGTGGGTGCATTGCCCTTGCTGAGGGCCCCAAAAGTTCGAACCCCAGAATTTAAA
GGGGAACCGGGGGGGGGGTATCACAGTCTAACTCTGGACCTTGTGCTTGTCAGCCAGGTG
CTACACTGCTGAGCTATATCCCCAGCCCCTTGATGGGGAATTTTTCCTGTGAGCAAAATG
AGGTGGTCCCTGTCCTTCAGAGAGGTGCAGAGTGACTGTGATGTCTTTGATACTTGACTG
CTTCACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCCCCTCCCTGGGAAAGGGGGGACCTCATGTGCTTCGGGTGG
GTTGCTGGGGGTTCTGGTCCCCTGACCACTGCTCAATTTTGTCAAGCCCAGTTATGGGTC
GCCTGGGCGTGATAAATGTAGAGATGCATCCTTGCTGTGACTTGGAAATAAGAGAGACCA
GTGAGAGGTTTGGAGAGCCAGCCCTGCCTTCACTGCCTCTTAGTCAGCAACAGCGTCTGC
CCAGCACCCCAGGCATTTCCAGGGAACAGGTCCAGGGGCTCCTGTCCATACACATGGTCA
GGCTGGTGCAATAGGAGGTGCTTTAATTTTGGGGTGCTGGGGAATCAAACTTTATTACGG
AAGAAGGCATTTAACAATAGGAACCGAGGAGCAGCCGGTGTGGTTTAAATGAAAGTTTTC
CAGGGCCTTAACAGTTCTGTGACTTGGGTAGCGGCGGCTGTGTGGTATTAGGACACAAAG
GCCCCAGCATTTATGTCCTGTTTGTGTGGTACTAGGCATTGGTCCTGCATTGCATTCTAG
GCCTTTTTTCTCCCCTTGAGAGACTGTCTTGCTCGGTCACTAAGTTGCCCCCTTTGGGCT
CAAATTCGATTCTCCTGCCTCAGCTTCATGTGCCACCACACCTAGCTCCTAGTGGTGTAG
TGCTTGCTTTGGACCTTCTAGACTGCCTGGCCTCCTCTTTCCTTCCCCATGCTGATCATG
GTTTTTCTTGTCAGATCTACAAGATTGGCCAGGGCTACCTTATCAAGGACGGCAAGCTGA
TCAAGAACAACGCCTCCACTGACTACGACCTGTCTGACAAGAGCATCAACCCTCTGGTGA
GTGCTGGGAGCATCCCGGGCCTGTGGAGGGTCCTAGGCGTGTGTCCTGCTTTGGCCAGGC
TGGCTGTGGTCGCAGACCAGTCCCTGTGCAGTACCCAGCTCCTGCAGAAGGGTCTCAGGC
AGCTGTTCCGTGATGAGGCCTTGGAATGCGCGCTGGGCACAGCGCCCGAGTCAGACTGAG
GAACCATTCCCTGTTGCCTTCCTTCTGAGAACAGCCCTGTTGTCCTGTCCACTGGAGACA
GTCTGCATCTGGGTGTTGTCTCCATTCTTCTGTGCTGACTCATGGCCTTGCTTTTTCCTG
CAGGGTGGCTTTGTCCACTACGGTGAAGTGACCAACGACTTTGTCATGCTGAAAGGCTGT
GTGGTGGGAACCAAGAAGCGGGTACTCACCCTCCGCAAGGTGAGTGGCTCTCAGCCGCCT
GCCGTGGAGGCTCCCAGGGCCGAGTAGGCTGGAAGGGGCTAGGGTGACGTCCCCAGCTGA
CACAGGCTTTGGAGTTCAGGCTGAGGAAGTGCACTGTCTGGCTTGTGCAGCCTCCACTGC
TTAATTCTGCTCATTAGCCTGTGGGACAGGGTGGGCAGAGCTGGGCTGTGTCCTGTGATG
GGGTTGGAGCAGCTGCCCTGGGAGCCACAGCTGACCGCCCTCCTCGGCCCGCAGTCCTTG
CTGGTGCAGACCAAACGGCGGGCTCTGGAAAAGATTGACCTCAAATTCATCGACACCACC
TCCAAGTTCGGCCACGGCCGCTTCCAGACCATGGAGGAGAAGAAGGCGTTCATGGTGAGT
GTCCCCACCTGCTGCTGTGCCAGCAGAGACTGGTCCCCTGGCTGTGGGTATTCAACCCCG
CTGCTGTTCTTCCCGACTTCTAACCTTTTCCACCCATGTTTCTGCAGGGACCACTCAAGA
AAGACCGCATTGCCAAGGAAGAAGGCGCTTAGCAGGAGCACCCTGGGCACCTGGTGGGCT
CTCAATGAACAATGTTGTTTCCAATGACTCCTGTGTGTTCTGTGAGGGCTGGGATGGAGC
TGTGCTGAGAGATAGACCCAGGTGGGGTGGCCAGTGTGGATGCCAGGACATCCCTGTGTG
CATATCACCAGGGCGAGACAGACACGGACAGTTTGCTCTACACAGTTTGGGAGACAGCCC
TGGGGCTGTGGAGTGGGATTTGGCGTTCTTCGTGCCTTTGTGGCACTGACGCATGTGGAC
ACAGCTGGCCCTAGAGCTGCCTGGTGTGCACAGAGGTTATTGATCCCCCCAAGCCAGTTC
CCATGTGACTTTAAGGTTTTTTGTTGTTGTTTTGTTTTGTTTTTTCTTTTTTTTCCTCTG
TACCGGGGAGTGAACTCACGACTGCCTGCTTGCAAGGCAGGTGCTTATGCCACTGAGCTA
AATCCCCAGCCCCTGACTTTAAGGTTTTTTAGCCCAGCTGCCGGCTCAGGCCCTGGGCAA
GGGAGTGACTCGCTGGAAATGAGCTGGTTTGCCTTGAGAAAAGCCCTGGTAGGCTCTGTC
TTCCAGGCACAGCTGGGTCACCTGTCCAGGCCTTCATGGCTGGGGTGGGGTAGCCCATGT
TATCACTCAGGAGCTCACACAACAGAAATGACCTCTGCATGTAGAGGACATAATTGGTCC
CTTGTGACTGCAACCCCTGATTGCCTTTCTCAGCGCCACAGGGCAGCTCTCCTTGTCACC
TGGGTACTTAAGGTTAGTGTACTGGTGGCAAGACATCTGCCTGTGGAGTGAACCTTCACA
CATGAGTGCCTGAGGTCCTGGAGTGTCCGAGGGACAGGTGTCTTGAGTAGGTGAGGAGGG
CAGGTCTGGGCCTTGCCAGGCTCCATGTGTGTACTTTGAGACAGTGTCACTGCAGCCCAG
GCTGCTGCCACCCGGCTGGGCTCCATGTGTATTTGTTTTGGGGAGACCATTGCCCTATGT
CCTGATTACTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1822..2014, 2492..2660, 3246..3381, 4520..4706, 4807..4967, 6184..6285, 6593..6688, 6944..7063, 7177..7221
1001..1003, 1822..2014, 2492..2660, 3246..3381, 4520..4706, 4807..4967, 6184..6285, 6593..6688, 6944..7063, 7177..7218
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved