Cavia_porcellus Locus NOL5A
snOPY snoRNA Orthological Gene Database
Cavia_porcellus NOL5A
Cavia_porcellus
NOL5A
GeneScaffold_2774
SNORD110, SNORA51, SNORD86, SNORD56
2262..2332, 3050..3181, 4038..4123, 4542..4608
7162
agcaggcagtcatgagttcaatccccggtaccgataaaaaggaaaaaggcaaaaaaaaa
aaaaaaagtatatatacatatatgtgtgtgtgtgtgtgtgtctattctggctaacagtcg
tgagaatttaacacacaaaaacccaagaaagattaatttaccaaggcaaacactccttaa
ggataaccagggtttggatttttttaactctattttttagtattatatgtgatgccgaag
caagcacttaactctattatttaaaccaaaagtaaatttaaaaaccgtcacctgagcgcc
cacagccagacatggaagcagctccctaatcctcggagctacttgcattgcacaacttaa
ggccgaacccagccaagagcaacacgtggtcgcaagaaagagctaggtcccgtgaagcac
agcaagaaatcggcgtagggagactttggggtcttctttccatattatttcctgtcacca
tcttgttttcgttttttaaaataacattaaagaaaatgtaaacgcatgataaagacggga
gcgggggggggggggggctagcacccgaacgctccaggcctcactctcgtccaggacagg
gggaaatggggcaggcccccgggctcccgagggtggtccccgagctggacgaggggaccc
caaggtctgtagccagaggtcaccagcgctgcctctgcgaccctgtctgcgatagcggcc
ggactgcactgagctttgccgcccaccacatacttgctgagatcatatgggatcggacta
gctgcactactgctttcccgagccattttgcagcctccaggccgggcgaaataccaccaa
gaccccagcaccagttccgtcccgcgcagccgcagaaatccgaaaaggcctgttagcccg
cgcttctcgccactagcacccaacctctggactataccacctggtgaatccgcctccgaa
tgctcaataatggtatcgtccctggcttttgattggtcaatATGAAGAAGGCGTGGCGTT
CGGAGTCAGCTTCCGCGCGCCAGAGCTTGCTAGCCGCATTGCGAGCCGGGCAAACAGCAA
GCGCCATGgtgaggagtgggtgtgggttgtgggctatgcgaaggccgtggcgtgggtcaa
gctttgggttccagcctgttcctgagcttggtcctgctctgagagCGGGGCCTGGTCGGC
TTGGGAGCCTCGCTGACGTACGCGCCCCGGCTCCTGTTCCAGGTTCTGCTGCACGTGCTT
TTCGAGCACGCGGTCGGCTACGCGCTTTTGGCGCTGAAGGAAGTGGAGGAGATCAGTCTG
CTGCTGCCGCAGgtgggtgaaatctgtaagctcatccggctccactacatccttcgggct
gccgagccccagcatgcaccgcgcgctcccacgtggtcggccgcgcagggtgggggggct
aggctggaagcccctggagcagagagtctttaccttgattcctggttagaatcgcttaag
agtgactaggtataagcctcccttactgtactccgtagcgataagttagtacttgaggtg
cagggtccaggcatcggtaggttttaataatcagccgtttactgtactgtagtggtttga
gcaacaaaaaaaaagtcgtccgtcattttcttcacagGTGGAGGAGTGTGTGCTCAACTT
GGGCAAGTTCCACAACATCGTTCGCCTGGTGGCCTTTTGTCCATTTTCCTCTTCTCAGGT
TGCCTTAGAAAATGCCAATGCAGTGTCTGAAGgtgagtgcatagggagatactgagatgt
gattcctgctaatagtcctcttagtgggttaataacagtatttgcctttgagtggtttgt
tacgcgtatgtgatgtgtactgggcagattttgagatttgtacgatgggatctaaaacag
ttggtcctgactgctcaaggtctgacaagtatgaaagactaaatttcgatggcacacaat
cccacgtgtagggtttatttccttgttggtgttataatgataaataattcctgatggaat
gggtgggtgctgtgcctacctacacataagtactgtatgtagtttttttctgtgtcttcc
aacttattgggaagggctattctgataaaggtcaagaaaagggggtttggtcctaggagg
taaatcaggtactgaatgttcgaggacaggttatgatattcatatattttatgctggtgg
ttttggacctgagtccatcttagtccattgtcaagccgggctttgcagtgatgacttgag
aaatctgtcaatcccctgaatgtaatcactgatgtctccatgtctctgagcaatgcctga
aggggaaacctgtaagcatgccatcctgtcatgctctgtgggaccagcataagctgaagt
gataaatgagatcttttttgtaatgtaagcagtcttcagagttttagtggaagctctgtt
cttttccctgagGCATTGTTCATGAGGACCTCCGTCTGCTCCTGGAGACCCACCTGCCGG
CCAAAAAGAAGAAAGTACTCTTGGGGGTTGGGGACCCCAAGATTGGTGCTGCTATACAGG
AGGAGTTGGGATACACCTGCCAGACTGGAGGCGTGATAGCAGAGATCCTGCGAGgtgaag
tactcctgcagttcttgacaactttaaggggggttctggaaacatactaggatcctggag
gttgcttctgggaatgcctaccctctgggtgtgggaacaagcctaagtcccctgctaaca
gtcctaccttattcttagGAGTTCGTCTGCACTTCCATAACCTGGTTAAGGGTCTGACAG
ATCTGTCAGCTTGTAAAGCCCAGCTAGGGCTGGGACACAGCTACTCTCGTGCCAAAGTAA
AATTTAATGTGAACCGGGTAGACAACATGATCATCCAGTCCATCAGCCTCCTGGACCAGC
TGGACAAAGACATCAATACCTTTTCTATGCGTGTCAGgtaaagtgcagtatttgatctgt
agtttagctaatttttcatcctgagggtgggaccatgtgggctacagtagtgcctcctgg
tgcttaccacaggcagtgttcttacactgactgtatagaaaaaggaggaagagtaaacct
gccccatgtacacctcagcccaggccttgtgccttgtctgtattgtgaatggggaaacat
aaggcctgaggcagatttgaatctgacttactctgtaatctccggataacacaggcatgg
aaaaggttaaaggtgtggcagctgggccagagtgattattctcctttgcagGGAGTGGTA
TGGGTATCACTTTCCAGAGCTGGTGAAGATCATCAATGACAATGCTACCTATTGCCGCCT
TGCTCAATTCATTGGAAACCGAAGGGAGCTGAATGAGGAAAAATTAGAGAAGCTGGAGGA
GCTCACAATGGATGGAGCCAAGGCTAAGGCTATCCTGGATGCCTCGAGGTCCTCCATGGg
tcagtgcaaaaggctagcagctggcaaaaggtacgggactccgaatctctagcctttgtt
cacactaggtgtttcctagGCATGGACATATCTGCCATCGACTTGATAAACATCGAGAGC
TTCTCCAGTCGAGTGGTGTCTTTGTCAGAGTACCGCCAGAGCCTACACACTTACCTCCGC
TCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGgtgcgtcat
ggggaacacacatggtggggagcaagagtgctaccattcacactgctatatttttagacc
cacaatgtcttttccagttgggtgtaatggggaggaggagagcaggggttgtgcagctca
ggtcagcaatttctacttccttaaatttttctccagGTAGGCGCACGTCTCATTGCTCAT
GCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTACAGATCCTTGGGGCT
GAAAAGGCCCTGTTCAGgtacccgtgagggcacctgcccagatcaggtgccacttctggt
gcgcactgcttatatgggaatcacagtgatggctaatcagggtgccctgacccatgcaga
cctctgatatgggggtgatggccagtcctggtgtctgagtgattcccagggcccagcaaa
gggatcaagcttccaggtcagcgacattggatgtcttccatctgcctctgggagttgtgg
gttgatgtgttaacagtccagcccagcctgaggcttggctcatgctggagatttggaaag
ggagggtttgggaggaactaccttggctgataggattgaattaaattctccactaaatat
tctcagAGCCCTGAAGACAAGGGGTAACACACCAAAATATGGACTCATTTTCCACTCTAC
CTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCGAACAA
GTGCAGTATTGCCTCCAGAATCGATTGCTTCTCTGgtatgggtggaagggttggcaattg
gtagggctgggaggaaaagggtgctgagtaccttagcagcttctacaatgatggtaatat
ttttcgtcaacagagttctaatgagtgttgatatattgggtctgagtgaagctgagtgtt
gagggaattctgaggggtggtttatcactttggaggttaactagcttttctcccccacac
acccacaatcagAGGTGCCCACCAGTGTATTTGGGGAGAAGCTTCGGGAACAAGTTGAAG
AGCGCCTGTCCTTCTATGAGACTGGAGAGATTCCACGAAAGAATCTGGATGTCATGAAGG
AGGCAATGGTTCAGgtcagtgggctctgctgggtggtagaaaaacagttggctgctggag
gtgatgaactgtcttgacctgatcttgtataatggaggccaaaaaaaactgatttaatga
gcctgatccagtaatgctggaagactatatagtgagacatggaactccaggccttttcag
cactttgcttttgccagGCAGAGGAAGCTGCTGCTGAAATCACCAGGAAGCTGGCGAAAC
AGGAGAAGAAGCGCTTAAAGAAGGAAAAGAAGCGCCTGGCTGCACTGGCCGCTTTGGCAT
CTTCAGAAAACAGTAACACTCCAGAGGAACATGAGgtcagtcttggcaagtcagccctct
aggatcctaggctgtgggttttcagcagaactgaaggtgtgctgcctgcctcagcccagt
ctggagtccaggcttttggattgaaatatctaaaaaactacctcttgattctacatagga
aggagataggtgctgagacaacttgctcaagagcccagagagctggttatagtgcacgcc
tgttccctgggcaagttgtgttctgtcctcagctgcttcccagggactcttcagtaaatt
actgctctgcttattctcagatgtatccagaaatggtatgatttcacagttggcatgggt
gcagggaagtttccagtgtgccaggctagaatatttctctaaaggcatttagtgccattt
gcaacatggtttgtttttcctttgtaatttggctgatagatccactgtgaccagcatgga
gggtttttgtataagttagaggactgaagaaattctctttacatgttctccttcacttgt
aattgggggtagctctaggggtggctttccaatgttactggcctccccagaagcatggac
agtttgcttttctgccatgactttaatgggggaatgcacacacacatcctagataatacc
tcttactgccttttcttggctttagGAGACTCAGGAAAAACCCAAAAAGAAAAAAAAGCA
AAAACTCCAAGAGGTGCCTCAGGAGAACGGAATGGATGATCCATCTGTCTCTGTTTCCAA
ACCCAAGAAAAAGAAATCTTTTTCCAAGGAAGAGTTGATTAATAGTGATATGGAAGAGAC
AGCTGGTGGCAGCACAAGTCCACCCAAGAAGAAGAAGAAGTCTTTACCCAAGGAGGAAAC
TGCTAGTGAACCAGAAGAGGCAGCCAGGAGTGTCCCCAAGAAAAAGAGAAAACTTTCTTC
AAAGGAAGAACCAGTCAGCAGTGGGCCTGAGGAGGCTGCTGCCAATAAGGGCAGTGCCAA
GAAAAAGAAGAAAAAGCTTCAGAGAACTTCCCAGGAGGATTAGaatggacattattccct
ggggggtgggagtggggtgtgcccccacagtgacacttccctttccattccctaagtccc
agtcaataaaaataaatccacaaaaaattggttattacataggttttattgaacgcctta
tgtgggtgtgggcaggacctatgggtgggacagggcatcaatgacagcctcagtgaagtc
gtggcaagtggcatagccacccatgtcagaggtccgaacctgttggggagaatggtcatc
atcctgtggccaaggccccatcctgataaccccaccacatcacccagcatacacagctcc
ctaaggaagccagcctcaggacgacctaggcactgcctaggaaagccattatggtccact
gtctagaggtcaaggtctccactggtccactgaactgaagggatgggtgtgtaggtagta
atggtccttgtgaggttggagggattaaagggctctagaccccatgggggtgtagatggc
cgatgacagacttgatgaagtccgttgtggtactgtagccgcccatgtctcgagtccgca
cctacagccaccaccggcaacagccgtggggaaaaaaagaagagagcccatgaagcaggg
tagggcaatgtgatcagagacctgggacctaggaccccaaagtgctggagggccagaaaa
gactgctacagtagagatgaaagaggctgcaaggtgaggggaaaggagctgcttgttctg
agccagagctatgctacagaggctgagcagaagggagcaattgtaaagtgcccaccagag
agggtgaggttacctcaggaaacgacaaaagtccaggagagaaaaaaggaagtgatgggc
ttccaagcaaggagaagaaagtgaggctggcacctcaccctgcctgcttttggccccgct
gcaccaccccaaatagctacacccttctgcattcagatggcccatgaaaggggcaatgga
tacagcagaagagggcatagcac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1087, 1185..1331, 1657..1771, 2472..2633, 2778..2976, 3291..3478, 3559..3710, 3876..3976, 4326..4474, 4692..4813, 4997..5134, 5785..6162
1001..1087, 1185..1331, 1657..1771, 2472..2633, 2778..2976, 3291..3478, 3559..3710, 3876..3976, 4326..4474, 4692..4813, 4997..5134, 5785..6162
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved