Cavia_porcellus Locus ENSCPOG00000015205
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ENSCPOG00000015205
Cavia_porcellus
ENSCPOG00000015205
scaffold_204852
SNORA68
1578..1710
3075
AAAACCAAAAACCAAAAGAACAAAAAAACCCAAAAACAGACCTGAGGATCAATGGATTA
GAAGATACGGAAGCAACTTCTGACTTACTCAGCTACTATCTCTGACAAAGGAACCAAACA
CATTCACTGGAAGATAGACTCTTTAATAAACGGTGCTGGAAAAACTGGCTTTACACATGC
TGAAGATTAAAACTAGACCCATATCTTTCACCAGGCACTAGATTAAAATCAAAATGTATC
AAAGGTCTAAATATTAAAACAGAAACACTAAAGCTTCTGGAAGATAGAATAGGTAGAACT
CTTGAAGACTCTGGTGTAGGCAAAGGCTTCATCAACAAAACTCCAACTGTCCAGGAAGTT
TCACAAAGAACCAACAACTGGGATCTCATTTTATTTTATTAAAATTGATACTGAGGATCA
AACTCAGGATTGCCTGCGTGCTTGCAGGGTGGACACTTATGCTGCTGAGCTAAATCCCCA
GCACAGAGTTTCATTTTATTAAAAAGCTTTTGTGCAGCAAGAGAAACCACCAACAAAATG
AAGAAACAATAGTGTGGGAAAAAATGTTTACCAGTTGTTTCTCAGAGGAAGGACTGCTAC
ATAGCTGGGGATCTGGCCAGGATCCTCTAGTTGCCTGTATGAGGGGTACGGCAAAGGATG
AAAGAAAGAGCAGAGACAATATTAGGGTGCATAATATTGCTGGGAGATCAGTACCTCAGG
ATGGGGCAAAGATTAAGCCTCTTTGGCTGGCCCACTTTTATTTTGCCAGTGAAATGCACA
GGGGGAGAGATAGTGTACATTTTTTTTTTTCATTTTTATCTGTACCAGGGATCGAACTCA
CGACCGCCTGCTTGCAAGCCAGGTGCTTATGCTGCTGAGCTAAATCCCTAGCCCCTGATA
GTGTACATTTTTGGGAACAATGAAGAAGTAGTAGAATGAGGAACAAGTCACAAATAAACA
AGTTGCTTTCTGTGGGTGGCAGCCAGCCGGAAGGGATCGCTATGAAGGCTTGGGGCACAC
TCCGGGAATACAAAGTGGTGGGGCGCTGCCTGCCCACCCCAAAGTGCAGCACGCGCCGCT
CTACCGCATGCGGATCTTCGCACCCAACCGTGTGGTTGCCAAGTCCCGGTTCTGGTACTT
TGTGTTGCAGCTGAAGAAGATGAAGAAGTCTTCAGGGGAGATCGTCTACTGTGGGCAGGT
GGGGGTGAGGGGCCGCTCCTGTCACCTGGGGTGGGAGAGCCCAGCTCAACCAGCTATTCA
CTGCTGTCAAGAGAACTGTCTCCAGCTCTCCGTTCTGCAAAGAGGCCCTGCCGGCTGGGG
TGCTGAGGCTACAGAGTCTGCCCCTGTGGGGGTCCACTGACTGCTGTCATCTGTCCCCCT
GGTGCCAGGTGTTTGAGAAGTCTCCTCTACGGGTAAAGAACTTCGGCATCTGGCTGCGCT
ATGACTCTCGCAGTGGCACCCACAACATGTACCGGGAGTACCGTGACCTGACCACAGCAG
GCGCTGTCACCCAATGCTGTAAGCAGAGGGCTGGGGTGGGTCTCATGGGGTCCCTTTCTA
AGGCCAGCCTCCACCCCACTTGCACCTCAACCCAAGAACCGCCACTTCCCGTAGTGACGG
TTTAAACAGGGGTGCACATAGTAAGTGGATCTCGTCGCCTTTGGAGGGCTGTGGCTGTGC
CCACCAAAGTGAATTTGGAGGTTCCACACCCCTCTCTGCCACAGTCTATGAGCTCTGAAC
CTGAGCACTGTGTCCCCCACATTCCACAGACAGGGACATGGGTGCCCGGCATCGTGCCCG
CGCCCACTCCATTCAGATCATGAAGGTGGAGGAGATTGCAGCCAGCAAGTGCCGCCGGCC
GGCCGTCAAGCAGTTCCACGTGAGTGCCACTGACGCAGGGTGGAGGGAGGGGGGACATGG
GCAGCCATGCCTGGGTGAGCCCCAGAGCACTTGGCAAGGGCCCTCACCTCTGTACCCCCA
CAGGACTCCAAGATCAAGTTCCCGCTGCCCCACCGGGTCCTGCGTCGCCAGCACAAGCCC
CGCTTCACCACCAAGAGGCCCAACACCTTCTTCTAGGAGTGGCCGTGGCAGTGCCAATAA
ACTCAGCACCTGCACCTGGCTACTGTTTTCTTTCATGTCCTGTGGAGCACAGCAAGGGGT
CCCCAAGGGGCCACTGAGCTGGACACCGCTCCTGCAGGCCTCATAGACCAGTGGCCTGGG
GCCCCTTCAGCTCAGGACCTGGGCTGTGAGGCTGCTCCCTCTGCTCTAATCCACATAAGG
AGCTTAAGCCTGGCTTCAGTGCCATCTCCTAGAAACCGAGAATCTCAAGCATGTACCGCC
TGCTGGGCTTCTTTGGGGCATTGGCCTGGCCTGGGGGTGGGAGGGTCACCAGAGGGCCCT
CAGTGTCCACAGCAGTGACATCGCTACCCCAGCTGCAGACTGGAGGGGTCACTCAACAGT
GGGCAGAGCCCTCTGCTGCCACAGCCCATACAGCATGGCCCTGGCAGTGGTGCTTCCATG
TGGGACTAGCCATGCCTCTGCTGAAATGTGCAGACTTTGCATTAACATATGGATTCGGGC
TCAGACATCTAGTTACCGTACATAGAGTTCTTTTTAAACAGCTGCCTGTGGAGAAGCCTC
TGAGGAAAAATACTCATTTCCCCAGCCATCCTTCTGGTCGTAGTACCCATGTGACAGCAA
TAGGTGCCATTTGTAGAGCAGATGCCATACCTGGATCCCCTGTGCTCCAGAGTTGTTAGA
TCCAAGGCTCTCGTGGGTGTAGTGCTATATTCCTGGCTCTGTAGCTGTGCCAGGAAGGAT
CCCTGCCCATCCTGATCTAATGTGAGTGTCCTGTGACCTCAGGCCCTAGGTGTCCTGAGG
AGAGAAGCAGAGCCCAGCTCAGCAAGGGCTGCACTGCCACCATCAATCACCATCCTGCCT
GGGCTACACAGCCACCCTCAAAAGCTCATGGGAGGCCATCCAGTCCCCATCTCTGTCCAC
CACCTCCATCTACTCAGGTTCCATCTGCTGTCCATCTGCATGGGCTTCCTTTACCCCACC
CCCAGCTCCCTGCACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 1075..1197, 1388..1517, 1769..1878, 1983..2075
1001..1072, 1075..1197, 1388..1517, 1769..1878, 1983..2072
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved