Cavia_porcellus Locus PPP1R1A
snOPY snoRNA Orthological Gene Database
Cavia_porcellus PPP1R1A
Cavia_porcellus
PPP1R1A
scaffold_257522
SNORA61
2950..3065
4370
CCCCGGGCTGGATGGGCTTCAAAGATGTTATCTGCAGATTGCCGAGCTACAAAGAGTTA
ATGTCTGCTTGAGAGGGGGTGGCTACGGCAGCCAAAGGAAAGCCCTGTGCCCTCTCAGGT
TATTTCTGACCATTGATCCATGATGGACGGAAGGACAGCAGGCCAGAGATCAATGCATTA
AAGCAGATAAAGCCTCTGAGATGAAGAGCTGGAGTAGGAAGGGGGCATGCAGGAAGCGAT
GGTCTTTGGAATTGACAGGAGTAGCTCTTCTCATAAAGAACAGATGAGCCCAAGGATATC
CACATCGTAGAACAGTGGGTCCAGTGTAACATGGCATTCTGAAGTGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCAGGC
AATGGATCGTACAGTCCCATTCTGCTTAGAAAGTCAAGCTCTTTAGTACTTTAGATTTCC
TGTCGTTACTGCCCTTCTCCATTCCCTGATTCCCTTCAGAAGTGGATGAAGACCGGATCC
CCAACCCACTTCTCAAGAGTAAGCTGCCCCCCTCAACGGCACCTTCCATACACATCAAAA
AGAGCTGTGCCCAACCTGTAGGCTCCCTCATCCCTGCACCCCATCTCCAAAAGACACAAG
GGCACAAGTGGACAGCCCTCTACATACACATAGACACACACACACACACACACACACACA
TAAATCTTGCCACCACCATGAAAGTGTCTGGAGGGCAGGAATTTTCTTCCTTCATCTTTC
TTAAGCCCCAGCCTCCAATCCAAAAGCAATCAGCAAGGTAGAGGAGGAGGGCAGGAACGG
CTGACACCCATCTGTCCTCTTGTCCTCCACAGTCCACTCTGGCAATGTCTCCACGGCAAC
GGAAGAAGATGACAAGGACCACACCCACAATGAAAGGTTGGAAAGATCCCTCCCATCCCT
TTTTTCTCTATAGTCCTAAAGCTGAGTAGACCTGATGCCCCTTTGGGAAGGTCACTTGGG
TGGTCCCTGAAACCCCTTATTATCAGAATGCAGCTGTTGCCCGATGATAGGGCTAGAACC
TCAGCTCTGTGACCAACCTGCAAGCAGCTAGGCAGAAACTGCCTACCCCACCCAGCCTTG
AATACCACCTAATCATGGCAGATAAATAATGTATGTGAACTCATCAGCATTCAGCACAGC
CGCAGAAGGTACTCAAATATTTCCTGAATCTAAATGGAAACTTTTCCTGTCCCCAGGGGA
GACCACATATCCCAGCAAGTCAGGAGTACCTGGTACAGTACTCTTCACAATTCTTCCCCT
ACGCCTCCCTTACCTTTGAAAGAACTTTTTTGCAGTCTAGCTTTTGTCCCTCCTTATTAC
CAGCTAATGTCCCTCCTTGTCATATCTCAGTGGATGGGAAAGTCAAATGCCCAGCAGTGT
GTGCCAACCCCCGAGCAGGCTGTTGATGGATGGAGAGAGGCTAGGTAGTCACGTCCAGTG
TTCCTTCCCTTTCTGTCTGCTCCTAGAGCTCCAGACAATGGTTGAACATCACCTGGGGCA
ACAGAAGCAGGGAGAGGAGCCTGAGGGAGCCACGGAGAGCACAGGGACCCAGGAGCCCTG
CCCACCTGGGATCTCAGGCACAGAAGCGGAGTCAAGGCTGGGCGTCCAGGGGACAGCACA
GAGTATGTACAGGCTTTAAGGGCCCCAGACACTGTTCCCCAGCTCAGGAGAAGGCAAGAC
ACACACTGGGGAGCAGAGGTAGAGTTGGGCCTGGGAGAAGTCTTAAAGTCATAAAAAGGC
TGTTCAGAGATATGGACAGACTTGCGTGGATCTGAACCTTCACTTCTTCTTGCTGGCTTC
AGCCATCCCAGCTGGGACCCCAGAAGTCTCGAATCCACCATGTGTGGAGAAGCAGCATCA
TGGAAAGCACTCCCAGCTAAGTCTGACTCTGCACTTGCCACTTAGCTGAACTTAACCTGG
GTTTATAAAATGATAATGGGATTGTGAGAGTCCTTATGTCATTAAAGTAAGTCTAAAAAA
CAAACAAAAACCATAAAAGAAAAAAAGGTGTCTGGCAGTTAGTTCAGCAGCACTGATATA
AAGTGTGATAGAAATGGAATCTGGTAGAGATGGTGATTCTAATCCATGTTCACAGTCCCT
GAATTCAGAATTTGTCGATAATTTTATGAAAGTGATATACTGTCTATCCTATATATATCA
GAGCACTCTATAATCAAACACATTAATAATTCTACAATCTGGTGAATGGGCTGAGTGGGA
GAAAGACTTCAGGTCAGGTATAACCAGTGTACCCCAATTTTTTCCACGTTTTTAGAAGCT
CTTTTTTTTTCAGTATCTGAATGCAGATAAAAAGTAGCAAGTCTCAGTCAGGTGTGGTGG
CTAACACCTGTTATCTCAGGCCTTGGCAGGCTGAGACAGGAGGATCACCATGAATTCAAA
AAAACCTTAGACCCTCCAGTTTCCTTTCCCATCGGATCTGAACACTGTTCTTGGTGATCA
TCAGGGAGGGAAAGGAATGCTGAAGCTGGCCTCACAGCCTTACATGCGGGCTAGTGTTTT
GTTTTGTTTTTGTTTTTGTTTTAAGTAGCAAGTCTGTAGTAATAACGGTGATCAGAGGAA
ACCCTGTTGTTCCTGCCACCTTGCTCCCACGTGGGTCTCTCTCAGGAGTCACTGGGCACA
GGGTACAGTAAGCAGCAGCAATCCCTTTTTCCAAGGCCTTTATAAATGTTCTCTCCGTGA
TACCCCCATTTTTCTTCCCAGAATCTGCAGGATCCATCCCTAAAACTCAGGAGAGGAGCA
GGAAGCAGCCTAGCACAGAGGAACCCACATCCCATATACCACCCCTGGACTCCCAGGGAG
CCGACTCGGTAAGACCCCAGGGTTAGGCCACCAGGTTGGCAGGACAGCCCTGTGCTCATA
AGGACAAGGGACTCATACTTGGAATCAGAGAAAACAAAACAAAGGTCCAGCTCTGTCACT
GGGATATTCTTATGGGAAGGGGACATATCTCCCTGGGACATAAACCTGGAAGAATGGGGT
CAAGCTGCAGCAGAAAGGGATTGAAGTTAGCTCTGGCTCCTGAGCAGGGGACTTATTGGT
GAAGGACATTTCACCAATAGTGAAACACAAAGGGAGAGCCTCATCTGCCCAGGCTAGTGG
GCAATAGCCCTGCCTGGAGATGGAGGACAGATGAGCTACTCTGAGCTCTGATTTTACAAT
CCTCACTCCCCCACATAGGCTGGCCAGGGGTGGAGGAGACTGACTCCAGAGCTTCCTGAC
GAGGTGGATAGTTGGGCAGACCAGGGAGATATGAATGCACCTCTGACGGCTCTGTCACCT
TCCCTTTCTGTTCTTTTCCCACAACAGGTTTGAAAGGAGGCGGCATCCTGGCATCACAAC
AGCATTGGGAATGCATGGACACTGGATCTGTTTCTTACCTCTTCACTTTTGGGGAAAATC
TCATTTTTAAAAAGTGATAAATTTGGTGTTAGGTCCTTGGCACTTTCCTTCTTTCCAGAC
TTGGAGAATCCTTTCTGCCTCCTCTCGTCTGAAACCCTCTTACCCAGCTACCTCTGGGAA
GGAGGAAATAGGGTTGCTGGGGAGAAACTTCAAAAGGGTTTTTCCCTGACCTTGCCTTAA
CCTGCTGCAGAAAGAAATGGGGGCCAGGCAGGTGGGAGGACTGACCTCCAAGATGCCAAG
GAAAGATGGTTGCAGGTTCTCTGCTTCTTAATGAGCAAAGGTCCAGCGACCTGGCAGGGC
TGCCTTAACAGCTTTATGACTTGGAGCCCTTAAAAGCCTGCACCGGCAGTTATGATGCTA
TGGGCGCCACCTTCTGGGGAAAAAAGGAAAATGCACCCCGGCCTTTGGCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 1352..1415, 2006..2161, 3261..3370
1001..1036, 1352..1415, 2006..2161, 3261..3370
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved