Cavia_porcellus Locus LOC100723839
snOPY snoRNA Orthological Gene Database
Cavia_porcellus LOC100723839
Cavia_porcellus
LOC100723839
scaffold_228406
SNORD83, SNORD83, SNORD83
1229..1304, 1821..1897, 7169..7244
12692
cactatgtagcctaggcagccttgagctcgcctagcctcatcctctggtgtgcttggat
tgtagcagtgcgccaccacgcctggcttatttagttttatttattttttattttttttta
gcaaatccatcacaggggtagaaaagcggccctcagtacagactctcctcagaccaggca
gttgtttgtcagcctgtctgtaggacttaaacttatgagatcgattgtgagagccaatgt
ctcatacaaaaaagctcgagaggcatttcagtctttaaagctttgctagctccttacaat
gtatgtggtagagtcagacccatttgaaaacttaacaaatgtgccagaaagaaactacca
caactatttagttttaactctgcaggccgatttttgttcctgatgcacagaccttggtct
cctcctaagggcacgagctgcatcagcccgtttaactttgagctttgcccctggaccatg
aagcgcgcctcactcctgacaaacgcgttcctgacataacgtttactcggtcctcaactg
gggccagacggttctccctgcgcatgcccagcgatcctccggtcaccttgaccaccgcga
caaggaccccgtgggaaccgctggttcccccgtcgcgctgtttgtggctcgcccatagag
gggttcccagtgagaacacatgaggaaaaaacccaaacaaaaaatgaagggcgtggaaaa
gagtggggcaagggaacacgtttgtcgtcgttatgtcttttgttattggaggtagcagag
gagttaagagtggctttacaattttttttcggacaggcattttccaaaggtagcccgggc
gcgcggaactacagtatttccgaaggtcctcttccggcaccttgcgcctgcgctctggca
ggcgtaaaggcgggcggccgcggtagagggaagcctggaaccggaagtgaaggttgattc
cctccttcgtcgctgtttctgccgccatacgcgcttgccctGCTCAGGTAAGCTTTGGCC
TTCACTACCATCCGCCTCCATCTGCGGTTCTCCTTGTTCATCCTGCCACGCGGGTTCCTG
ATATTTCTTGCTCGGGCGATGGTCTGGTCGCTGGGGCTTACTTGGgtagttattttcatt
gctttcattcttttctagagcaaagagctgtttggggggaggcagggaagaaaggggggc
ccaaaatccaagatggtggtaccggcgccattgtgttccttttcttcgctcctggctctt
ggagtgggtcactcccgacccgaggctccagcgactgcgaggggcggcgctcggcgtccc
ttgctgcgggctgtttgtggagggcggggccctcgtcaccttcccccgggcctgccctag
gccgaggtgggatgaggaggagcccgcctgtggggccggttggacctgtctcgccggcct
tctcgtcttatctgaaactgtttcgaaatggggatatcattgtttttcggaagatatttt
agcagattaggagcccaagcgtaacgtgagactgcttggtaaacattttgttaaaagctg
gaaaggggatactgtaccttttcattaagctgcttcgctgcagtgacttaattcttgttt
tatattttgttgctattttgcagcgctggggactgacgcttgaccccctggcgcgctagg
cgagcacgccctgagctgcgctccgtgtctttgttttgtgttgccactgaggcatttttc
tttcccttgctccccaccactgactgtacaggatttcctgagcattggaagccgctgctg
aggagtgggaggtgcacggcagccacatgatgttctgatctgagacgtgagcgctctgcg
cagtgctgaccctgatctatcaccctggactgatggctgccgtgcagggatcagcgcaga
gggatgcagggagagctcaggatcctccctaggatgttccaggactgctcatttccattt
gcacctctcctaagtgctagatctttttcagcttctcgtgatgcttttttttcagtgtta
ctataaagaaagtttttaaacattaaaaaaaaaatttttttttaatttttacttttgaga
ctggcgtttcactgtgtaggtcaggctggctttgacctctgagggccatcctccagcctc
agcctcagcctccggagtgctggggttacaggtgtgcacccctacactggctcagagtat
ctctaaattgtcttcgtattgagctggtttgtgctactgtgagccacagtcttcctggca
tccatgttcgcggaagctactttttacatttttctattacagctgcttttcatttgtagg
ctttgtagctgtgatttttcttcccagctgttgtagtttagggaaagtaggaagggcgag
gcagtggaaaatggtgaaagtctgctcctgactgatacgttttgctgttttgttttgttt
tcctagCTCTTCTGTCAGAAGTATCTTTCTTCCCCTTTGCTTCCTGCACCCCCTGCTTTT
CCCCCTGGTTTGCACCTGTTCTGGGAGACCTCACCCAGAGCCCCCTCCCCGCGCCTCTGC
CGGCCCAGTGATGGCAGAGAATGATGTGGACAATGAGCTCTTGGACTATGAAGACGATGA
GGTGGAGACGGCAGCTGGGGGAGATGGGGCCGAGGCCCCTGCCAAGAAGGATGTCAAGGG
CTCTTACGTCTCCATCCATAGCTCTGGTTTCCGCGACTTTCTGCTCAAGCCAGAGTTGCT
CCGGGCCATTGTTGACTGTGGCTTTGAGCATCCCTCAGAAGgtaaattttctgttagcct
gagagttctccttgggcacttcaggggctcctggacaaagatggttttcagatggtgaag
attaacatttagaatagtacagggcacaagtaccaacaattgtcttaataacagaaaggt
ttgtttagtctttcctgatggcaccaaagtgccagtaatccagaaccagtttagatggca
gactgccaatgtgcctggttttttcttcttgtctgtttgttttttttaactttgcggttt
tggctattaagttttcagaaaggacctagtcaggcctttagtttccccttttgggccagg
ccagagctggtctctggaaacatttttgactggcctagaaacggctggcttttgggtcag
gtaccaagtgcttcattttgttcaaggttgcagggttacgtgacccaaagcatggcaacc
taagtaggcgagatggcctgtggcaggcattgaaatgtcacggattgttacagtttaaga
aacataaggacagagccaggagcactgaaggtgagcttttgggaggcgcaggaggtcatc
agctcctctgggagctggacctggaggacgggggctcggacaagctaggggggtttgatt
tggcattaacgtgaccagaggtcagagaggtgcatagggcctgaaagtttgcaagaggca
cttggagaactgagtgggaaaacacggctgtggtacaaaaggtggtgaagttgtttggag
acaagtcttgatttctttcttttctttcttgtagTCCAGCATGAGTGCATCCCTCAGGCC
ATTCTAGGCATGGATGTCCTGTGTCAGGCCAAATCAGGCATGGGAAAGACAGCAGTGTTT
GTCTTGGCCACACTGCAGCAGCTGGAGCCAGTGACCGGGCAGgtgtgcttggggagtcgg
gagggcgcttgggttaggcccgcatgggatgggagcctggccccgctgcagctcttcaag
ctatgagcaagcgccttgccagctagcaggaatattctgttaagtgtggatttaattatt
cagacctcagcgctgacgtcatttggccctcacttccccagagggaatatcgaggggcat
gtgcttcctgtgactagggcgacctgttttctccccagGTGTCCGTACTGGTGATGTGTC
ACACTAGGGAGTTGGCTTTTCAGATCAGCAAGGAGTACGAGCGCTTCTCTAAATACATGC
CCAATGTCAAGgtaagcctgccagaagaacccagggagaatatgggtgtgggggcacatg
ccctggaaactggaacaggtgcatgaaaactcctgcctacttgtaaatggcaggaaactc
ctgcagactcgagtgtgcaagagattttacttttggtttccattacaagctcagaggtgc
cagctgtagtttaatttggagaaactagtttgcattggcttaacacagtgcagatacacc
tgtgctgcatgagagtgtgtgattgctgtgctgatccgtgccacagcagggggttcagcc
tcatttgggaacttgctggaattgatcagctgggtgtgaaaataccaccgcaaaggcaat
tcccgtgcagctagaggtgacaggcactggcttatgatttcctgtcatgctggcttcagt
gaagaacagcgctttctgttccagttgttacaagttttctgttagtactttatagtttag
aggaactaggagtgtgagagtcatagccctaaactgaacgtttcttaaaaatcaaacaag
tagttgttcttaattgacgtcttactggggaaaagatgtgttttcccagctgtaacccat
tttcactgaaggtgatcgcttaccccaccccagtgtagccgcctggtgcctgctgggcag
gtgcccccacccctcctgggcagtgttttcttaatttgtcagtttatagtactttgtgac
tcctttccacggaacattagttggttcacacttgtctgatgttctgaaaaccgcttattt
aacccttgagatgtgacttgaggccaaggaagctgggcagtgtctgtggtgtacttgctg
cctttgcgccgagcaggaaggtgttcacatttgtgttgagttcagcagcgagccagagtt
gcattctccctctgcagccccagcttagccaccctcgggtcactcaagggactcggggtg
ctgcggtccaatgagactgggcagtcatgcagggcactctagtgcctgctatgggaggct
caggcaggaggaccacttgcacctaggggtgaaggccaccctgagaaacacaaagagatt
ctgttgaaaaaccacaaaagccagtgcacatggcgctccctaactcgcacttaatcctgc
tcagatccatcctgggtttgtgtgtcactcccttagtgtcttgcttgctgttcctcctag
tatttcatatcggctacaatttatatttcaaagtgtaactgattgaagttaatcattcct
ggcaggaatccttcctgggtgggtgctcctgacctcctggtgtgctgcaaatgtcactca
ttggcggccttgggtttaccctggaaggaaagacttccccagaatggggatttggatggt
ttgatcccttgactgtttttaccctttgaagctgaaaggcagtttctggaggtgtcccta
tactatgaattaaggctcaggtctttatcagctgttctcctagtggtttaatcatgggta
ataaatacacgtagtttaaatcagtaactgagactttatgtgatagttcttttagaacag
cttgatgtttcatgtttttttgcggggtgtgtgtgtgagtgaaggtaatacaggaggtta
aatctggggccttcaaactgagtacattctcagtacctcctttttaaattttacttattt
tttgtctttttgagacagggtctcactgtgcagttcaggctggcctggagctcactttgt
agcctaggctggtctcagaacttgcacagtcctgcgccagcctcccgagtgctacgatta
caggcatatgcagacatgcctggcccctcagctctttttgtgttttgagacaaagttttg
ctaggctgttcagatggcactggaactggtaatcctcctgcctcagcctcccaagtgctg
ggattataggtgtgcactgtgcctagctcatgtgcttttgcttgtgtgtctatcaggttg
tgtgtgtgttttattggtacattttagatatacataatgataacattcatcctaaggtat
ttgtacttgtatgtgatacatctttttttgtaatttttaaaattttttcatcttggggct
ggggatttagctcagtggcataagcgcctgccttgcaagcaggcattcgtgagttcgatc
cctggtactgataaaaacaaaaaagacccccccccccaattttttttttttcatcttgct
ttttttccccatcatcctttccagcccctcttcccctccttatttacaaaagctttgttt
ccatttttttcttgtgctgtctttttctcctctcacctgcacatgttcttctcatttccc
agtatctgttagacgtactagtccttgtttatttattttcattggtaccggggatcgaac
tcacaaccatgcacttgcaaggcaggcacttatgctgctgagctaaatccccagccccac
tagtcctcatttatacattgagtttctcacaccagggagacggtgcagcattgacacatg
cgtgtgccgtttatttcatggaagttgcatccgttgagctagaaatggctcaggctctcc
cgagtgcttttcgtggcactcggtgatgctttcttgctgtccttatccttaaactgaccc
cttagagtcctgagaagactacgcttaggtcaggacacaggcacttgatgctttcacatg
gctgggaaactcaccttggttgtcacctcagtatctgggcacccataggaattttggtac
tggggactgaactcacagccttgtgcttgtgccactgagccgtatccctggccgatttct
taagttgttcattgtgaagtgtgctgagttgattagaggagtcctcctgacagaatggga
ggtgggatttccttccttgtgagactgtccctggcctgcagGTGGCTGTGTTTTTCGGTG
GTCTGTCTATCAAGAAGGATGAAGAGGTGCTGAAGAAGAACTGCCCCCACATTGTCGTGG
GAACTCCTGGCCGCATTCTTGCCCTGGCTCGAAACAAGAGCCTCAACCTCAAGCACATTA
AACACTTCATCCTGGATGAGTGCGACAAGATGCTTGAACAGCTCGgtgagtggcggctgg
gaggtggctgtctgggagatgcctctggtgccagatgatgttcgttggctgcaggagcac
ttggtgcgaggacgactgtttacctatcacccatgcctgatggctcagagcgccctgtcc
ctagactggggggtacgcgttgtttcggtggtgtgtgggactgaacccagggcctggtct
ttgttcatctggacttttcctttgtaattttctgttctggcagACATGCGTCGGGATGTC
CAGGAAATTTTTCGCATGACCCCGCACGAGAAGCAGGTCATGATGTTCAGTGCTACCCTG
GGCAAAGAGATTCGTCCAGTCTGCCGCAAGTTCATGCAAGATgtaaatacccttctacct
tctctccttccactccccgcccgctgagtcctcccctcctcgccctcttcctccagactc
ccgtcctcagaccccagaggaggcagtgccgtcgggagcgatgactcctggaagagacag
agaggcagagacagctagcgctagggtctgcgccaaggctagggaaactccggaagactt
ggtcgggttacagagagcggggagcgggccaccttttccacccggcggcagtcctgaacc
agttctcccttggcggagggcaggttggctgccctcctgcctcccgtcatcttcgcagcc
ccatgcagccacgcacctcaaggtggcagcgagcatccggcttctgctcagactcacagc
tcccaggcaggagagcagagagggacagacagcaggcagggcccagccgtgaagaagagc
agctcagaggagtgtccctcccaccccggggcgggggcctcgggcccccagcccccaccc
ctgcccttcccgcccacccctcctggcacccacaccatcggagcctcggtccatggcgac
gcgagctggcagcaagagaagcttcatggcgacgcgggagtgcgacacaccgagctgtgg
atggcggcggcggaggccgcggggagcctgaccaggaagcggaggaccaaaccagctctt
tttctgttcctggtttttttcctgaacctaacaggagctgcgccccgagtgcccccatac
atgttggggaggggtgtcctaagtggggtggtggattttttttctttaaaaaggttattt
ttaaattctcagtggagagggtggggagaggtgcagtggaacgctctcctggaccatgag
caagcagctgtgagggtcgggctgggtgcagccgtggagcagcggggctgttcctccccg
cgtgttcgtccttggggtgatggagtttatagttctgagtgggccagaattgggtgtgag
ttgcgtttagagagcctggcttgctggcttgcttctccaggtgtccacttttttcctgtg
agacacagaccccttccagtcttgatgccctgtatggtgtgaagacaccgggtcctccaa
gacgctacagaggccaggggtgtcgggggttggagctgccctttgtcagttcctgactgt
tttatgctactctcctccgcccccaggggttgagtttgtttttatttttagtttttagtg
gatgtgtatttgctgctctatttgcttttctgttagcatcaagtactgatagtttccctg
taaacctgttgatggttttaccagtagagagcagtgtcgcccacatgagttgcttgtggt
ctgggagcaagctgccactcatctccagtaatttttctctttaaaatgcgcttgattaca
tccactgtagccctctggtcttggaggcatctgctccctcaagtgcatgagactgtagtt
tggagaactaatgaagccgtcggccgaggtttctggccccaggactgtttcctgtggtcc
tcggtgtcaggtcacggcctcctctgtgcctcctctgtgcgctgctgttttcttcctcct
acttcattggaggtgccggcttctcggcatggggtggtttcactgctctgttattttgtg
aatttttcccatgagtattcatttgggggcagtcttaaaattcaactgatgggaagcaga
tgaggtcacgtgaaggaccacaggaaaatgggtatttttggtggtggcggggtttccagt
ctctcctcccatccccccatggggtgtattggagatcagcttcctccacccccccaggtt
taacccccccactctgccctcctcccgtccccaccccttcctccctctcagCCAATGGAG
ATCTTCGTGGACGATGAGACCAAGTTGACGCTGCACGGGTTGCAGCAGTACTACGTGAAA
CTGAAGGACAACGAGAAGAACCGGAAGCTCTTTGACCTTTTGGATGTTCTTGAGTTCAAC
CAGgtcagtcgttcaggtccagttgggggtgaggctgggccccttctccagctgcgccag
aaacctgtggcagagtagtcttttttttttttttttttttggtctttttcgtttttatcg
gtactagggatcgaactcgcgactgcctacctgcacggcaggcgcttatgccgctgagct
aaatccccagcccctgcagagtagtctttattgagggtgcatgcagtataaggtttcctt
ttttggtgccaggggtcaaacccacgactgtgcctactgggaagtccctaactgaactgt
gcccaactgtgagaaatttccttcttggtggtgtagacattgatcccaggccttcacagc
aattcacgtccccagtcctttagggttttacccaggccacctttgacctatgatccgcct
gcctcggcctcccagggtactggattacagacagggtgcagtgccatgtgtgacagggaa
atcctctcagagggaactgagttgagcaaggtggaaggtgcttttgtttcctggctgaag
agataagatagatacgagagagagatactgggtccttcaagacggtacagaggccagggg
gtccgggggcttggagatagacaagagagcttaaggaagataaccctcagagtaaaatcc
cagggggagtttataagtgtgtaagaagcggttcgagtttggaaaggcgtgcattcttca
gtggagaggccagtctgtccttttacctggtgtggtctgtccgcactaaaaactgcgctc
tggagctaaatcgagtttccttagatttagtgttgtgccgagggagagtcaagagtctga
tcttcgcggagcttttcttattcctagcgtgtggccgagaggcagcctcctgtcctccta
ggcctggcgatgtgggtttctcttccttgcgccgcctcagggctgcccactgaggaaaat
ccagccccggaaggctcttatctctagtgcagaagtgcaaatgcgtgatggaaataagag
gaccgcgggccttttagagtaaaattcctgaaaatccgcaccataacttgtctcccgccg
tggccgccgcgggcccgcagGTGGTGATCTTTGTGAAGTCTGTGCAGCGCTGCATCGCCC
TGGCCCAGCTGCTGGTGGAGCAGAACTTCCCGGCCATCGCCATCCACCGCGGGATGCCCC
AGGAGGAGAGgtgcgcgtagtgggggcggcgggctctggggaggaggagccgggagagaa
ggcactcaaccatgtttctcatttcctctctcacaagGCTCTCTCGGTATCAGCAGTTTA
AGGACTTTCAGCGGCGGATTCTCGTGGCTACCAACCTGTTCGGCCGGGGCATGGACATTG
AGCGGGTCAACATCGCCTTCAACTATGACATGCCCGAGGACTCGGACACCTACCTGCATC
GGgtgagcccctggcccaggggctcctacgtctctcctcctctccctgggtgcctccccc
tccgggtcttctagtgttccctttgttgccttcagGTGGCCAGAGCAGGCCGGTTTGGCA
CCAAGGGCTTGGCCATCACGTTCGTGTCGGACGAGAACGATGCCAAGATCCTCAATGACG
TGCAGGACCGCTTTGAGGTCAACATCAGCGAGCTGCCGGACGAGATCGACATCTCCTCCT
ACAgtgagtgtggtgccctggaagcagccgcccggccgcttagtgtccccttgtcctgag
cgtatgggtcgtgggtcccttgcatagggaggggtgcctgatgcacctgggacttgcccg
cttccttcctcctggtctttgatggctgttgggagagttttgacgtcctgtgggaccctt
cttcccgccctctgtcaggtggtttctcctccttctcgcccaagtccacccctgaccctg
cccagtcacaggcctgtgcaggtcctcgcctgggtgccccgggtttggcctcagctcact
cgcactcatgttctctgcagTTGAACAGACTCGGTAGAGGATGCGCCCTCGCAGACTGTG
CCAGGACCTCTGCAGGAGAGGACACTAGGCGTGGGGGTGAAGGAGACACTACTGCCACCT
GCCCGACGGCCCCCACCCTGTCCCGAGCTTTCTCCTTTTGCATCACCACCACTCCTAAGC
TCCGTTCCCAATTTATCAGCATTTTTTTTTAACAAAACTAAAAATGAACACCAacgtgcg
tgtgtgtggtgtctgttaagtctgtgcctttggtccttcattgtgtgtctgagcctggga
cagttctttggggctgtgagcccagccttggggtagggtcagcaggccgacccgcgtctc
tgccctcctcccgccttccctgtgttctcctctgggtgggggctgggcaggaaggcgggc
aggctgtttgcagtgcctaagggcgctgggggaagtgaggcatctcccctgttcctgcag
cttgtgccagtcaaactccgggcctgggcctccatccccatcctgcccgtgcaggatggg
agcagctctggctgctgctcggggctgaagcccttggaagaagtgttgcagtggacgccc
ctgcctcccctagagcttttctcatgggcttgcagattgaacccagggaacactgagttt
ttctgctttttaaagtctgaggcagtttagctaagctgtccaggtctggggggcttcctg
ctgcagcaagcacctgcacctgcctctgcttgaagcttctgggctcagccatagcggggc
tgcaggtggccttgctgccccaggggctccagctgtctgcccctgtggggatgagtgggg
ggagggagctgagaggtttgttttgggggggggtgagggtgaagcgctggagttgaggtg
cagcagggatccaaggggttcccatgctgtgccagcacagatgactcacccctcaccctt
gttgccacctaccctgggagtgacctgtttctcccaagagttgagctcacctgttttttc
atgctggccttggggttctggacccctctacggggtccctgagggaccaagggcctagga
ggcctcagcaaaggtgacaaccaccagtgagcccgggggaggcctggggcttgctgtagg
cctgtcctcacttccgggtcactggccaggccctgcccctgcccgggctgccccctcctt
ccgggctgctcaggtggagcctggtcttaaggg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1124, 2466..2800, 3574..3701, 3938..4030, 6941..7124, 7363..7481, 9351..9482, 10580..10689, 10777..10921, 11015..11162, 11480..11692
2590..2800, 3574..3701, 3938..4030, 6941..7124, 7363..7481, 9351..9482, 10580..10689, 10777..10921, 11015..11162, 11480..11496
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved