Cavia_porcellus Locus RPS11
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPS11
Cavia_porcellus
RPS11
scaffold_182251
SNORD35
1981..2068
3725
gtcacagctcatggggccttgtcacgggcttactaaccttctcaaactgcagacaacac
agcagcccgggtattttcagtagatggtggtttctttaccagaccagagaagctagctgt
gcagagacttaaaagcacaaagctctaccatacgatgtaatgtttccaaaaccaggatcc
acttaaaaagataagggccaggggctggggatttagctcagcggcataagcccctgcctt
gcaagcaggcggtcgtgagtttgatccctggtacggacaaaaaaaaaaagtaaatgcaaa
tctgttgttcagcacagtaaccattagccattgggcctatttaaatttaaagccactaaa
attctcagcagcaaaagccatgtttcacatggctagagtgatggcagcggcacagaacat
ttccactctcgccttgtacatagaaaacaccagaaccacccctccgtcacagtctggggt
gaagtgggacacgagaaaagtaacttcacaaagcttctgaaatctggggggaaggctccg
cctctcacaatggcggcaccgtggcagtcctaggacccttgtgcctgtcccacaggaaga
tggccgctgccatctcttcccgttccgagcctacacttacaccaccatgcggtctccaat
ttccaagcgaacgtacgccccgcaaaaacagggcgaccttcttacaagtctcgcgagaat
ataagccacacccattctaagagtgctttcaggcggaaaactagacggaaatctcgcgga
cagtgtgcacgttttccgctcctccatccttcaccattatggccgcgtccatgtggtccc
cgaatcgtgtggttgggtaatgtcacctgtcgatcaaaatcgtacctacagtaccgccca
caaacgtgggcccgcctcctttcgtcacttcctgcctagaccctgcacagtcgataagga
aacccgcacggtacggtcgctctctttttctgccggccgggAAGATGGCGGACATTCAGg
taggttctcggagctggggccgaaagagtgggccctcccccgccttcctagtagcttccg
ggaatacagggcactgcgccgtttggagtttattccgggcgtttcctatcgggtaggcag
taaccggaacgacagatttaacgtagattactgctttctaaatcctgcgaactcgcatgt
taatggaatgtcaagcattttaggagttaaactttttttaggtggttatatgttcggtct
ttaaccttaaggttttaattctggggatgagtcctaaggggtgaattcaggtagcgggag
gtgtggagcgtacgaattgaacagtcctggcttagattggcgggcatctgtggattgcag
ataaactcagttttcagagtggacatgtggtcccaggctactatctgggaactaactccg
tagagggtgggtctgggggctccggaaaaagcagttctagtccaagtcttggcctatgcc
aagttcaccagcttccttctccatccctgcagACAGAGCGCGCCTACCAGAAACAGCCGA
CTATCTTCCAAAACAAGAAGAGGGTGTTGCTGGGAGAAACTGGCAAGGAGAAGCTCCCTC
GGTACTACAAGAACATTGGTCTGGGCTTCAAGACCCCCAAAGAGgtgaggaaggaatctc
ctaagaaaacaagactgcccggtgcctgcacgtgtgggagtggaggtgtcttgaccatgg
cacgtttgccgctggggctgctgggaattgtagtttgtgtctttgaggtcacgcccccat
ttctgttaagaacaaatccggtgttcactcctccaatgctttttatccttccagGCCATC
GAGGGCACCTATATCGATAAGAAATGCCCCTTTACCGGGAACGTCTCCATCCGAGGGCGG
ATCCTATCTGgtgagtgggggactccagggctgacctactggaagaagcagttggggccc
tggcaggtgatgtctgttctcacgatggtcttcagaagcctgccacaggcactgctgaga
aagctgattggcaacactgatgccagaaacagggtttggggacccatgctcagctgattc
tgcttcattcccagcacgacctgggctcccatgactccttttccaacaaggcctgagtga
ccaatgatctgttgtctcgctcccaactcgcagGTGTGGTGACCAAGATGAAGATGCAGA
GGACCATTGTCATCCGCCGAGACTATCTCCACTACATCCGCAAATATAATCGCTTTGAGA
AGCGTCACAAGAACATGTCTGTGCACTTGTCGCCCTGCTTCAGgtgagtgacagggctga
gagtcctggcacatggcagccaggaagtcgggtcaggtttattgctgctgtcctgtgtgt
caggactaaatgccttatgacagtagcctgggagcagggtgggtggctgcatgtgctaag
ggggtagcatggtccccaggctgttctgggggcccccctgggccagggtcagtgggtgac
actttctgaaggtctgctcctgcccgcccccacagGGACGTCCAGATTGGCGACATTGTC
ACCGTGGGCGAGTGCAGGCCACTGAGCAAGACAGTTCGCTTCAATGTGCTTAAGGTCACC
AAGGCTGCCGGCACCAAGAAGCAGTTCCAGAAGTTCTGAGGGTGCTTAGTTGCACCCCAA
AAGGAATAAAATTATTTTGGCTCTCAcagaccaggcttgggtctgtcatggcgaggctct
gggtgtggtgggtgacatggttgggctgccctgcctgctgcatcctggggtccttttttg
gcccttgtcactttatgaacccagctacctggtgctggcagtcctctgccctccagtctc
tggggaggaagtgaggagggtggaggtgccctatgttgtggctctagtcacagtgtctcc
tagttctgggcttcgtctgggcctcctgcctccccaccagctaggagaggggccccagag
accctttcaccccacataaatacctgggtaggggcaggcaccagccagtctacctcaagg
cgtgagaggttcgagtttgtgtcctttgctgcaccaggggctatgcaggctaggccagcc
ccagggagcaggcctccaggacaagtggcctggaagggacctgatgagtagcccagatct
cagtaccccctttccccctcattgagcaacctcccaggccctcctccccagccacctcct
ttttggataggatcttgctaagctgctcatcttaggcttgagtttgtggtcttcctgcct
cagcctcccagagtgctggggttaacgggtgtgtgctgtctcaccctacttgggacctaa
caacccgagaaagcagggtcctcagttgactcataagtggggacagggtcaagatgtaga
agtgggaagtggcaactctggcagccccagagcatcctctgtggcagccagggccagagg
gtagtgcagaaaccttgagccgagaggtgggcccacagacacacaggccaggactctgca
gagcagatgtcagaaacattcagaaaggacagaaatgagcccagtactgaggaggctgag
gcaggaggactgccgagagcttaaaggccaggtctgaactacagcaagagcttatcagaa
ataagcaggaagaaaggaagtcttgcacctgagtgtagtccaggatgcctgagggcagca
agatgc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1532..1663, 1854..1929, 2193..2322, 2555..2725
1004..1018, 1532..1663, 1854..1929, 2193..2322, 2555..2678
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved