Cavia_porcellus Locus Mono:672:SNORD29
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:672:SNORD29
Cavia_porcellus
Mono:672:SNORD29
GeneScaffold_2648
SNORD29
1001..1063
2063
ACAAACAAATCTACTGGCTGATTTGTTGAAGTAATAACTAGATAAATAAAAGTGATTGC
CTCCTTAATTATTTTCCTTAGGAAAATCTTGGAGTCTAAGTCAAAGTATGTTAAATATAA
AATAGGTCATAGAAATGTCGTCGTGAATGGAATAAGTTTTCTGGGTGTGCTCTGGGTGTG
AAACTGAGTAAACAATGTTGTGACATTACTATTTGGAGTGGATAATAATTAGTCACAGAT
AATTAAACTCAAAGTATTCTACATTTTAATCATCCAAGACAGAAATAATTTATTTCCTTT
CACCCAAAATGATGATGATGACTTTCATTTTTGGTCTATCCTTTATTTCAAAGTATTTAG
TAACTGTAAACAATGTGCCCAAGATAGATAAGAGTTCTATGTCTGAAATGAATTGGAAGT
CCTTTTGAAATATGTTGCGATATGGTGCCGGGGGTGTAGCTCAGTGGTAGGGTGTTAGCC
TAGCATGCATGAGGCCTGGGATTGGATTCCAAGCATCACCATGAAAGGCAGAGGTGTATA
TATATATTGTGAAATGACGAGATAGCAAATACTCATAATTATTTTATATGTGCCCATAAA
AATGTTATCTACTTTCTCACTGATAACAATATTGATCTTCTTTTATTTAAATTTTTATAG
TTCCTACATTCTGTAGAATAAAATTCATTACTGAGTTTATGTGTAAATGTATAAAATGTA
CAAAATCCTATTTCCCAAATATTTTATGCATGGTCCTTTGAAGGGTCCTCCATGAAATCA
TTTATTCAAAGTCTAGCGCTCTAAGTTCTTATTATCAAGCAAAAAATTCGGATCGGATTA
GGTGTTCGGACCTGAGCCAACTGGTTATGGCCAGGGAGACAAGGTCTAAAAGCAGGAAGT
CTGTGTGTTCCATGGACTCTGAGCAGGACAGATTCCCTGAGAAGAGCTTAGGGAGGGGTA
AAACAACTGGACTTACGGTAGTAATTTTAAAAAGACAGAATTTTCCATGATGAATTTAAC
TAGCTCACTATGACTGACTTTTCACACATGAACACCTGAGAAATGGGGCATATGACAATG
GAGAACAATTTGGGCTGTGAGGAACCTTGTCACCAACCAGTTTGGTCTTTTCTTTAGGCA
CTGTCCCCAACAACCTACTTGGTTCAAAGATCCAGCATCGTATTTGGAGGCTGGGAATGC
TTTTAGAGAAAGTAAACCATGTTTTTTAAGACAAGGTGTCCCTATGCCATTCAGACTAGC
CTTGACTTCATGAAAACCCTCCTGCCTCAGCCTCCCGAGTGGGATAACAGGCATGCGCCA
CCATTCTCAGCTGCGAATCATGTTTCTTCTCTGCTTTAAGACAGGTCTCAGGAAGACACA
GTTTATACAAACAGTGTCCCCAGTCTTGGAGAATAAGAACAGGATTTCTCCCTGACTGTT
GAACTTGAAAAGTAGTCTCAGTAATAAAACTATTTTCTCAAAAAATAAAAATATAAATAA
ATAAAAAGGATTTGGGGTGTGTACATATATTAGTCTTTTAAAAATTGGGTTTTGAGCCCC
CGTTTACCAAGAACCTAACAACTCCAGTGTCACTAAGATGACAGAATAGCTTTTGTTCTT
TGGTTTCTTAAGACAGATAACATACTGATAATGACAGTTTGTTGCTTCCAGCTCGTCCAG
TTGTTATCTTATTCAAACAAGAAGAGGACCAAATGAGCCACAAACAGAACTTAAACAACT
CTCTAATACTGTAGTTTTAGTGCCCTAAATATTATACTATTCTATATTATTTTTTTAAAA
AAACCAGTCATATTTTGTCTATGATTTTTAAGGTATGTATCCTTCACTTGTTTTTATTGT
TATAAGCAGCATCAGTGACAACTTGGTTTTACAGACCTTCACATAAAACACGTATTCAGA
TTATCACAGTGGCTAGGAAGTATTTAGAGACTGCCTGAGACTGGAGATGGAGTTCTCTAT
TCTAAATAATCAGACTAGGATGCAACTCAGCAGTACGTAGCACCTTACACCAGGCTCTGA
GTTTTATCACAAGCACTGCCGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved