Cavia_porcellus Locus Mono:469:SNORD101
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:469:SNORD101
Cavia_porcellus
Mono:469:SNORD101
scaffold_217422
SNORD101
1001..1075
2075
AGTTTTTGGGCCTCCGTTGGCCGCGCCCCCAAGAGAGAGGGACGGCAGGAGGCTGTCTA
CTGTAGTGCCTGTCGCGCGTGCCAACGCCCGCAGAGCAGGCGAAAGGAGAACACGCAGTA
CTCTTTTCCTTCACAACAGCCGCAAACCGGAAACAGAAATTCTCGAGATCTGGCACTGCA
AGGGCCACCCTACTCGTGGGACTACGTGCACATGCGCACAGCCGGCCAGCCAATCCTTTA
AATAGCGTCCTACGGACGCATGCAGCCTCTTTCCCTGCCGCCGCCGAGTCGCGCGGAGGC
GGAGGCTCGGGGTGAGTTGCTCTGGGAGGGTAGTGTTTCTGGGTGATGGTTTGGTGACGT
CTTTCTCAAATGGACGACAAATAATTTGTTTTTAAGTTTAATGCTGTGTGGCCTTTGTTT
TCCAGTGTGTTCAAGATTCAACTTCACCCGTAACCCGCCGCCATGGCCGAGGAAGGGTGA
GCGCGGGGTCCGAATTTGGCGTGCGGGCAGGGCCTGCGCCGTGTGGGGCTGGGTCTGCGG
AGCGACGCTGCTGGCGTGCCTTTCGTGCATCGCCCATGCTTGCGCCAAGTCCAAGGGTTA
GGATGTTGCGAGGACCTAAGTGAAGGCTGTGTTTCGCTTCTTTTTAGCATTGCTGCTGGA
GGTGTAATGGACGTCAATACTGCTTTACAAGAGGTGCTGAAGACCGCCCTCATCCACGAT
GGCCTAGCACGCGGCATCCGCGAAGCTGCCAAAGCCTTAGACAAGTACGTGTGTGAGTCT
CAATACTACGGTGGGTTGTTGCAACCGGAACAAAACCGCAGCCGAGGGAAGAAAGCGTGA
AGTTCAAGGTGTTAGCACAAAAGTTCTGAATGACATCCGTTCAACAGGAAACCTAGGAAA
AGGTATCAGAATTCAGCTCTACATAATAACCCACTTAGAACACGTGGGTCGCTGTTTTGG
TGTGGGGTTGAGCAGTAGATTTTAGAGTAAAAAGCTACAGTGTTTGAATGATGACTTAAA
GTTGTCGGATACCCCTTCACTCCTATCATGAGTGAAACATGAATAGTCTGACAAACCTGT
AGATGATAAAGTGAGTTTCACATTGACACTATAGTGGGGGACCATATTTAATACAGCGGT
TANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved