Cavia_porcellus Locus Mono:308:SNORD113
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:308:SNORD113
Cavia_porcellus
Mono:308:SNORD113
scaffold_254775
SNORD113
1001..1076
2076
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCCAGGACTACGGTTTAAAACAGCCCTATTCTATATTTTATGAATAAAAGGAGCAGTT
CAGTTCCAAGGTTCAAATACAGAGGCATAACTATGGGATGGAAATGTATTGATTCCTTTG
CCAAAATTTTATGAAGTTTCAGGCAAAAGATATATGAAGTACTCTTAATTTGATCCTTAC
ACACTTACAAATGTATAAAATTTCTACCCTGTGCTCCATGCATTGGCACAGCTGAAATAA
CGATTAAAAGGATAATGAAGAGAATAAAGTTGTTTCTAGTAGAACACAAATGAGCCTCTC
CTGGACACGTGAAGACCGCAGCCCGGGTGAGTGTCAGGTGAGGAATAGTACGTGTCTGCA
GCTCTGAGGTCCGACAGGAGAGATAAGTGCATAATCCAGCATCACTGGGGCACTGGCTCA
TTTTTCATCCTCTGCTCTGCTTTGCTGTGTGCTCAGAATAGATGCTCCCGGGAGGATGTG
TACATTCTTTGGCGTCACCATCCATAGGTCACATCTCTGCATTAGAAGTTAGGACCAGTG
TGAGTAATAGTCAGAGACCTGAGTGTAGCTCAAGTGGTTTGTTTAAGGTTATTCATTGTG
TTCCATAAAAGTGTGAAGTACAGTTCCATTAGTCCAAGTGTAGTCAACTTCCAAATGGGA
TTAATGGAAGCAGTATATTGAATTATGCATGCATGAACATCGCAGGATGCCTACCGGAGG
AAACACATGCATGTCAGGCAGTTCTTCATACACACAAGGAAAATCAGAGCTGCTCCTTAC
AGTGTTGTCAGTCATTATAGGGTGTTAAATTTTTACTAGTGAATTAGTTGTTCAGTCAAC
AGACGATGTACATGTGGAGGGAGGAGAAACGGGGGCCAGCCTGGATCGAAGGTGTCCAGT
GATCAGAGGCGAGGGAGTCAGGGACTGTGAATGCCTGTCTGGAGCTCTGAGCTCCAGCCC
GAATGGACCTCGCCTCGATGTGTATGTGTCATGCCGTTCTGAGGACTGGATCAACGTGTG
ACTCAATGAGCAAATACTCAAAGGATTCAGTATAAAAATAAGGAAACGCTCCTGGTTCTG
TGGCAGCATCCTGGAATCCCAACACTGAGGGCGGTGAGGGCGGAGACTCCCAAGTTCAAG
TCTTCTCTGAGCAAGAATTTGAATTCCTTTCTCAAAATAAAAAATAAACAGCGATGGCAT
ATAGACGGCATGTGGCCAGCATCCCTGGGTTCCATCTTCAGTACAGGAAAAATAGCAGTG
GACATCGTCTGGGTGTGTAGTTACAGCATGAGATTAAGAAAATCCCTTTAATAAATAACT
GAAAGCACAGAAGTCTAAAGACAAGACAGTGGCACCTGACTGTCAGCTTTCTGGCTAAGG
ATAATATCCCGTCAGTGAGAATCACGGGCAGCGTTTATGCTGTGAGTTGGTGGAAAGCTT
AAAGATGTTCTCTCGTAAGGAAAGGAAATATTCTCCAAGTAGCAGCTGCGTGCGTGATTG
ACTGAATGACAGATGACAAGGAGATTGGCCTTGCTGTGTGTCTCGTTTCTCCCTCTGCTG
AGCTCCAGGCTCCGCAGAGTGGCTGCTCCCAGGGTCACCGCTGACCCCTCCCTGGTCGCC
TGTCTGCTGTTGCAGCTGACTGTCAGACCTTGGGGCAAATGTTCTTGTCCTCGCTGGTTC
CCTTTTGAAAGATTTTAAGTATTTTGTTGAAAAGGATTAATGAATTAGTGACATAAACAG
GCACACAGCCTTCAGTACCTGTGGTTCCTTTTACATGAGAATCCCCAAGCACACATCACT
GAAAACATTACAATGAAAGACAGGTCACAGGAAGTGGGCAGCTAGATCTTTCTCAAATGG
AAGGTGCCCAAGAGATGGGCAAGGAGGAGGGAGGCAGTGAAATCACCCTGTTGTGTACAG
GTGCCAACTTCCCGGATAGAGCCAACCATTGTGGACC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved