Cavia_porcellus Locus Mono:152:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:152:SNORA2
Cavia_porcellus
Mono:152:SNORA2
scaffold_286159
SNORA2
1001..1137
2137
AATGAAACCACACAATGTGTACAATTTAAAGAATTTTGAGAGTGTGAGTATAAATAATG
AGGGTATTTTTGCAGAATTGAGAAGAGCATGAATTAGTGTATCACTTTGGAGAGTTTAAT
GACAGTTGGCAAAATTGAGTACTCATAGAGCCTTCAATCCAGCCACATCACTGTTAAGCT
TATGCCCTAAAGTAAGGAGTTGGCAAACATTTCTTTTAAAAGAAATAAGATAATATCTTT
GTGGTCATAAAGTCTCTTCATAATTATTCAAATCTGTTATTTCAGTATGAAAGTAGCCAT
CAGTAGTATATACACAAATAAGCATTTTATGTTCCAATAAAATATCTGTAGTGCTGTAGT
AGAATAAATTAATAAATAAGATTGTATTAGTTACTTTTCTCTTTGCTGAAACTAAATACC
CAAAGTTAAGGAGGAAAAGTTTATTTGGCTTACAGTTTGTAGAGGCTTCAGTTCATAATT
GGTTGGCTCCAAGGCAGGGTGGCATATGGAAGAGGGACAATCATTCCTGGCATGAAAGAT
AACAGAAGAAACAAGAGGCGAGCAAGACAAGACAAGCCTGTTTCTGTCTCATATCATTCC
AAGTCTACTAGGATTAGGGCAGTGCCAATCTGATCAGTAGATTGATCCAGAAATCATCTA
TCCTTTATCCCAAGCACCACATTACAAATCAGTCACATGCTCTAGATCCAGCCACTTCTA
AAAAACCTACCCCTCAGTAACTACATAAGGCTTTGGGGGGACATCTAGACACAACCCACA
ATAAAGTTCCTCTATAAGATCCTGAATAAATATCATAATGTAATTGTATTAATTAGGGTT
CTCTAGAGAAATAGATTGCAATATAAAATGTATGTATAATTGAATAAGGGAATTTATCAG
TTAGGGTTACAACATCAGAGGTGGAAGAGTCCACAAAGGCCTGGGAGGATTTAGTAGCTG
ATCAATCCAAGAAGATGGAAGTAATAGAACAAGATGGATCCCTGGCTCTGGATCAAGGCT
GGCAGCTTCCTGATGCTGTTGGTTTCAAGCAGGAGCCTAAAGAGATGTCTTTCTATGGTC
TATTGGACATTGCAGAAATTGGGCAGTGAAATGGTCAATCCATTAGAAAGAAACAGCTTG
AAGAAACCTCTCCCTGGCTTGGTGAGCAGCTGTGAGCGTGGCAGGCTCCAGTGGCTCATG
ATGGGAGCCACTGGCATTTGCTGGAACCTGTGCCATGCTGGGACCTGGAACACTGGTAAA
CCAAGCAACCCCCCCCCACCTGTTTTGTTTTGTTGAACTTCAATATACATGAAAGTATGG
ACAGCTGTTTTGAAGAGAACAAGAGACTCTATGACAGCCATTAATGACTTCCCTATTGTC
TGGTTTTGAAGACCTAAAATGCATTCCTTATTCTGTTCAGATCAGTTTCATACTATGTTG
TTTTGTGTGAATTCTCTGTATGCAAAGACATGGACAACTATTTGGAAGAAAACAAGAGAC
CATATGGATAGTGAAGATCTCAGGTCACCTAGCTTTGAAATTTATATCTCTTATGTTGCT
TTCTTATGTCCTATTTTGTTGTGTTTAATTTTATCCCCTTTAAAATAAAAAAAGATGGAT
CAAGATACAGCACTAGTCCAATGTCTCAAGGTTGATGGACCAGAAGTTCAGAGAAGGGTT
GCTAGTGCAGGTCTCCAGTGGAAGGCTGACCATCTGGGGACTGATGTCCAAAGGCAGTGG
TGAAGAATGAAGCTCTTCTAAAATGGGTGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved