Cavia_porcellus Locus Mono:207:SNORA12
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:207:SNORA12
Cavia_porcellus
Mono:207:SNORA12
scaffold_289522
SNORA12
1001..1142
2142
GCCACTTGCTTAACTGCTCAGGGCCCTGCATGGGATTGAACCCTGACAGCATCCTCACT
TGCACTATGACCATAGTGGAACAGCTGCAGCTCCCCACATAACTAAGGCAGGAAGAAGCA
GACGTGAGCGAGCCCATCACTTCTCTCACTGTACTCTGCATCCCCAGCACTCGTGGGCAC
AGGCCCCCAGTTTCCTCACCTCACCTTGTATTATGAGAATTAAGAATCCAGGTGAAGTAG
GCTGCTGTCATCTAGCTTTTCCCACCTCCACACTGAGACCAAGGATCTCCACATTTTTGG
GAGGAAAAATAGTGTATCCCAACCCTGTCTTGTAGGAAGAGATGGATAAGCAAATCAGAG
TTAGGAACTTTAGAGTCTGCACAGTTCAAAGGAGAGAGAGAGACAGAGACAGAGACAGAA
AATGTTCTGCCTGAGGCACAGATGCTCTGACCCTCCATCCCAGGAGTCTGTTCTCTGGAT
CTCCCCTTGCCTGTGCATAGGCACAGGCCTGGCCTGAGAGCTCCAGTGTGTGTGTTCCAG
GAAATTTGGCCATGGTCTCCTGCTGCATTACTAGTAGCCAGCAGGTTATAGGTTGAAAGT
ACGCTGGAAATTCTCAATGCATTTTATAGTCAGCTGACTTTTTTGGATGACACATAGATG
ATTGTGGCATTTTTGGCAAGAGCTTGGAGAGCTACAAGAGTATCCTGAGGAAAACAATCC
AGCATGTGCCCTCTGCTTTGTGAGCCACAGGAATGACCTTAAGCAATTCTATAGCTCAAA
GAGGGTTGCTGTTATCCAGCCTGGATGGTGCCTCTTCTAAATCCCCGGACACCCACATTC
ACCTCCCTGGGGAAGCTAACCTAGAAACTGTAGCATTTTATGTGCACAGAAAATCACTAA
CAAACTATTATTGAACATCCACAGGTCACTTGCCTAATTATTAAATCCATATTCAGAAAT
CAAAACCAGCTTCAAAAGAGTTATTGCTAGAAGTAAGTGGGATATGGTGTGGTAGTTTCT
TTCTTTGTTAAGTTTTCAAAAGGGTCTGACTCTACAACATACACTGTAAGGAGCTAGCAA
AAGCTTAAAAACTGAATATCTCTCTTGAGCTTTTTTTGGTATCAGATAGTGGCTCTCACA
ATCTATCTCATAAAGTTTAAGTCCTGGAGCACTGGGGATACCAAGCAAACCCCCACCACC
CACCACGGTGAGCGGCTGTGAGCATGGCAGGCTCCCAGTGGCCCAGGACGGGAGCCATGC
GCATTTACTGGGACCGTTCCATGCTGGGACCTGGAGGGCCGGAAAACCAAGCAACACCAC
CACCACCACCACCCAGTGAGGGGCTATACGCATGCCGGTGTGCAAGCTGAGAATCAAACA
TCACATCACACCCCCAGGCCTTCTCCACTTAGCAAGTGGGAGCCAGTGATCTGGACATCC
CTTAAGAGGTTGACCATAGGCAATGTAGCAAATAGGGATTTCCTTCTACTATCTCTTTGA
AGGCAAATATTTTTATCCTTGTTTTGCTTTGTTCTAATTAATGGTGTTATTTTAACCTGT
TTTGTTTTGTTGAACTTCAATATACATGAAAGTATGGACAGCTATTTTGAAGAGAATGAG
ACTCTACCGACAGCCATTAGTGACTTCTCTATTGTCTGGTTATTGTCTGGTATTGTCTCA
TTCTGTTCAGATCAGTTTTATACTATATTGTTTTGTATGAATTCTCTGTATGCGAAGACA
TGCACAACTATTTGGAAAAAAACAAGAGACAATATGATAGTGAAGATCTCAGGTCATCTA
GCTTTGAAATTTGTATCTCTTACATTGCTTTCTTATGTCCTATTTTGTTCTGTTTTGTTG
TGTTTAATTTTAGCCCTCCCCCTTTGTTTTTTGTTTTTTTTTTTTAAATTTTTATTGGTG
CCAGGGATCGAACTCACAACCACCTGCTTCCAAGGCAGGTGCTTAGGCCGCTGAGCTAAA
TCTCCAGCCCCTTTAGCCTCTTTAAAAAAAAGAAGTGCATAACGTTTCAGTATATATTTT
ATAGCTCTATTATTTGAGGAAGAAACAGCAATAACTTGATAGCCCTAGAAATTTTATATC
TATGAGATTATTCATTTTTGTTTTGTGGNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved