Cavia_porcellus Locus Mono:270:SNORA16
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:270:SNORA16
Cavia_porcellus
Mono:270:SNORA16
scaffold_263155
SNORA16
1001..1135
1856
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTAAGTGTTTCCAAAGAAC
CAGGCCATAGAATTCCACTCTTCCATTAAGTTTGGTGTCTAATTATACAAATGCAGAAAG
TGAAATCACAGGAGGTGCCATGTTCTAAAGTGCCTGATGAGTGGCCTTAGAGCTCTGAAA
TTGAAAATAGGAAACAAACCCTCTTGATGACATGTCCAGAAACCTTAGCAGGTAGGTAGG
GCTCACTGGGACCCAGGAGGAAAGATTCAGAGGTAGGGTAGAGAATTTGGAGTTGAGCGT
TAGATGGGAGGAAAACATGTGAAAACTCAGTGAGAACCATGTTAAAGAGGATGTCGAGGC
TGAGCGTCAGAGACTCTGCTCTGAGGGAGATTTCTCAGCAGATTGCTATTCTTTATTTCA
AAACAGTAATGGCAATAGCTTGAGTGTGTCCAGCTTTTAAGGTTTATAGAACCCTGACAC
CCATTTCTTAGTCCTGTAGAGGTTACTGAACTGGCAGCTTAAGACTCATGATAGGAGGAT
TTGGCAGTCACGAGTGGCTTGCCAGGGCCGTCGCTCACCCTGATGCTGTGTAACCTGGAC
TGCATTTCCCGCCTGTTAGGGGGCCTCTCATTTCTTACTGGGTCTTAGGGAGAAGGCAGG
CAGGAGTTAAGGGGACTCAGTGTGATGGTCCCTGATTTGGGTATTAACTAAGCAAAACTC
ACTAATACTCATGAAAGCGTGGGGTGATATGAGTAGGGAAGAGCTTGGAGACTTACGTGA
ACGAAGTTTGGCTTTTTAAAAGGGATTTTGGAATTGGGGCCCCCATCCTGTGTACAAACA
CACGTGTGTGTGTTCATATGTGTAACAAAAATCTGTTTTGGTGTGGCCCTTATCGAAGCC
GCAGCTGCCTGTACGTAGTTGCTGCAGTCAAAAAGGAGCCCAGAGTAAGAATTTTCCTTG
ACGGTCGCCGTTCTGTTTGCTGTAACCGATCTGCAACATTTTGGGGAGAGAGCCACTGTA
AAAAAAAAAAAAATCTGTTTTGGCTAAAAGGCAGAAACGTAAGCAAGTGTTGCTCTCACA
GGGATGCTGAGACCAGTTTCCATTTTCATGTCCTCTTCACCTGAACCATCAGCAGACACT
TGAGTGTCCACCTTGCATGTTGGCAAGTCATCTGTTCTCAAATGATGTAGTTTGTATTCT
ACCATTTGAAGTGACTTTCACTAGCCACTGAGTTCCAAAAATTCCTTCACTTTGTAGACT
GCGCCTCAGAGATAAAGTGGATGGAAGGCAAGGCAGCCGCGTCTTGACAGACCCAGACCC
TTAGCCAGGCTCTTGCCTCCCAAGACTGGTGCTCTCTCAAACACTGAAGCCCGTGGAGAC
TTAGCGCTCCAGGTGGCTTCAGGGTTTCTTTAGATACCCAGGAAGAAAAAGATCCTTCCG
TATGTTTTCCTCTTCTGTTCAGAAGGGAGATCAAGTCAGGTCCAGAAAGTATTTCTTCTT
CCTGTCACTAGGCTCTGACAAAAACCTTACCATTGAGATTATTCAATGAGTGAGGCAGAT
CTTGATCCCCTGCAGTGCATAAGTGACCCAAACTCAAACCTACAGAGCATTCGGGACAGA
ACTGAGGGTCTAGGGGAGACCATCCAGCTCCATCTTTTCTCTCTGAGAAGCTCTCGTCTG
TAGAAAATTAAAGCCATACTGCATCTCAGAGGCAGGGCTTGGACTAATTTCTCTGTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved