Cavia_porcellus Locus Poly:7:SNORA8
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:7:SNORA8
Cavia_porcellus
Poly:7:SNORA8
scaffold_262922
SNORA18, SNORA8
1001..1127, 1852..1990
2990
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGTACACTCAGCAGCTGAGCCAGGATTGCTAATTGGAGTTTAGCCTATCTACCTTACTGA
AACAATTTTTTTTTTGTCTTTTTCCCTTTTTATCGGTACCGGAGATCGAACTCACAACTC
CTGCTTGCAAGGAGGCAATTATGCCACTGAGCTAAATCCCCAGCCCCCTAGTGAAACAAT
CTTAAAACAAAAAAGGCACTTGTTACTTAATACTCTGTTAAACACAATTATTAGAAACCA
TGGAGTGATTTTTCTGGCCATTAAGTATTCATATCCACTGCTATTGTCACATTGTTTTGC
TGAAGCAATGCACAATTCCTGCTGTTCCTATTCTAGGCTGTCTTGAGGTCTATCCCGATG
GAGCTTCTGTAGCTACACATCGCTGGAAACGCCTCATAGAGTAACATTGGTTTTGCTCTA
CTCACAGGTCTGCTTCTTAGGCCTGTGATAAAGCACTACAAGACAGCAAAAAGTATGCAG
CAAAAAGAATGAAAACTAATACTTTTTCTTTTAACTTTAGATATATTGCATGTCTGAGAG
CTCTGAACCTACTCTGAATAGCTTAGGTAAGTTTTCATTGTTGACAGCATAATACTATAA
GAATAGTTCCAGTTTACATGATGAATTTAACTGTTCAACTGCTGCATGATACAAACATGA
ACTAAAACTTAATTCTGACAGCTGGAGATAGCTATTGACTGCATAGATAACTTTGATTTA
CTGGAAATACTTAGTTCTAAATCTTTTTTATTTTGTAATTTCTCTGTAGGAAATGAATAT
GAATTCATGCATGTGTTAGAGAAGTAAGTGAAACTTGTAGTTTATCAAGGACTTAGAAAA
ATTGACAATAAAGGTCTTTGCACAAATGTGATACATATATTTATAAAATGAAAAATGGGT
GGCTATCTTTGCACTGTCCTTTGTTTATTTGGCAGCTGTACAGTTTTTACCCAAATATGT
AGCATATGTAACCTGGGGACACAGCTGAGCAACAGTGATCCTGACTCTTTTATTGTATAT
TGAAACCTTGAGAATTTTTACACAAGCACTTTACACCGAGGTAGTCCTTTGTGATTTGAC
TTTTAACTGCATGTGGAAATTGAACAGATAAGATGTTTATAAGTAGTGATCTCATTAGAA
AATGTAATAAATGTTAACTGGAAGTACAGTAGAGGATCTTTCCTCAAATGATTGCACTGA
ATGGTATCTGCACTCAACAGTTTATTCCTGCTGATGTGTTCAAAAGACAGTGCGACAGGA
ATTCAGTGTGCGGCATAAGAGGTTCTCTTGGCTGAAAGCACGTTAAGAAAGGTAGATCTA
CTGATACATCGTTGTTGTGATTCTCATCTTATTAATAGGCAATCTAATATCCTTGTAATT
TAGAGTGTCAGCAGTGCGGCAGATCTCTCTCGCCTAAATATAAGGTGTCTCATATGGTCC
AATGCTGCTAGGGTAACAGCAATTTATAAGACAGCCTCATTTTAGCAGGCAAAGGAAAGA
ACATGATTGCACTCCAAACCCTGCCCAGCCTCGGGCCAGGGTCCCCCTTCCAGGGGTCCC
CCCTCCAAACGCCTCCCGGTGCCACAAGATCTCCTGTCACTTCTTTAAACCCCATCACCA
TCTGACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved