Cavia_porcellus Locus Mono:157:SNORA11
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:157:SNORA11
Cavia_porcellus
Mono:157:SNORA11
scaffold_274876
SNORA11
1001..1127
2127
GAAGCGATTCCATGCCCTTGGTAGAGGCCTGAGGCATGGCTAGGATCTGGGCATTTGAC
CTCCCAGCACCTCCAGGGCTGCACACACTGTGGCCAGGCTCATCTGCCTAAGTGCATACC
CGCCACTGGCCAGCACTGTGACACTTTGCTGGGACTACTTTGCAAATCACTCTCCAGATC
ATGAATACAGAGTGGCCCCAAAGACCAACCTCATGGGTGTAACACGAGACTCTGGCCCCT
GAGACGTGTGTCCTGCTGGACCATTTAGACTTGCACCCGGGCGGAGCAGTCGGCCAGCCT
GCAGTGCCTCACAGCACAGGGAGAGGGAGATGCCTTTCGAGACTCAAAAGATCCTGTGTA
TGTTCCTGGACAACCTAGCAAGCTCCCATTTCAAAGGAAAAATTTAAAAAGTACTTTTAA
AGCTGTGAAAGCTCTTTATTATAAGCTATTGTTATAATGAATTATTTATGTCTTTACACA
TGACTTCGTATTACTGCTACTATTGCTACTTTCATTTGCCCTGAGAGGTGGCAAAGTGGC
ACTCACTATCACCCTCTGATGAACCTGGGACACGATTATGTACAGAAAGACAATGACAAC
GTTTAATAGTCTTTCTTTTCTTTGAGACAGGATGTCACTAAATTGCTCGGGCTGGCCTCA
AATTTGTGATTCTCCTGCCTCAGCCTCCCACCTGTATTTTCTCACTATCAAAAACTATTG
AGTATGAACTAGAGATGAGAGAGAAAATCTGGAGCCTGGTTTGTGTTGCTTTTGATTTGT
GTACTGAAATTGAACCCAGGGCCTTTGCTACATCACCATCTTTTAAAAATTTTTTTAAAT
TTTGAGACAGGGTTTCACTTATTTTCCCACGCTGGACTCGGACACACAATCCTCCTGCTT
CAGCCTTCCAGAAACTGCAGCTTATTACAGGCATGCACCACCATGCTGGCCTGCAGTTGA
GTTTTATATTATGTCAGGAGGGGTAGAAGTAAAGGTTTCTGGGGGTGTGCTCAGAGCAGG
TGCCCTGAAGAACGGCTCCTCTGTTTACAGCACTCCAACAGGAATCGAAGGTCATTGTGA
CAAGGGACATAACACTATGACTTCCCTTTGAGCAAATCTCCTACACATGTACTCTATATG
CTTCCATATGGCTTCTGGAGGGTGCCCATGGACAAGCTTCAGGAATGGGGGGAATGCAAT
GCATTTAGTGGGCAAGCTGTGCATTTTGCATCTGCCTGGTGCATCCATGGGTGATCTATT
GGTGGGCCCTAGAAGTAAAGACTTTGAATTTCTATTTTCTTTTTTTAAAATTTTATTTAA
AAGGAAAAAGAAAAAAAACCACAAACAAAACAAGCGGTGTAAGGGTACAGTAATACAGAA
CTACAAAACAAAACAAAACAAAACAAAACAAAAAAACAGTAGGAAATCACCAGTTAATAG
ATTACACATTTTCGTCTTAGAGATAGTTGTCACCTCTGCAGGCCTGTTTTTGCTGCCTAT
GATCAAAGGTAGACTGTATCTAAGGATGATTTTTTACAGCATGCCCCTACAAACTTATAT
TGTTTTCTTGGTATGGAAAAGGAATGGAAGGTTGGGGCCAATGACACATACACCGACGTC
TGAGCTCTCTGCACATGTACAGGTGCCGACAGAGGAGCTGGAGCTTGCAGAATGTGCAAT
GAGGGCTGTCTGGTGGCCCAGATTGATGTTTCAGTGAGTTAGAATCCCCAGAGGGTGCTT
AGACCTCTGGACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGT
CTGCTTCATCGGGGGTACACCTGCCACAGGGGTCTCTGTGACAGCTTCTGATAAGGAAGA
ATCTGCCTCACTTAGCAGACTCACAGGCTGCACTGGCTCAAGCCCCATGTTTATTATCCC
CTGTCCTGCTGCTCCCTGCAAGACAGAATTTAGTGCCTAGTTAGCATCACACCAGTAGTT
ACAGAGAGTTAAACAAAGACCCAGTTCATTATCCCTGAGGGAAGGTCCAAGGCAAATGGT
ATAAACAAACAGAAGTACAGCGTCAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved