Cavia_porcellus Locus Mono:344:SNORD81
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:344:SNORD81
Cavia_porcellus
Mono:344:SNORD81
scaffold_248933
SNORD81
1001..1075
2075
CCATTAAAAATGACAAAATACATGAAGAAATGCTTCAAGAGAAAAGACATGTAGATGAT
GAAAAAGTATGTAAAAGTTTCTCAACATTATCAGTCAAGAGGGAAATTTAAGTTAAACCA
ATTATCGCCATATGACTTCTAGATAGTACACAATTAAAAAGATTCCATACCACATGCTGT
TAAGACTACAGGGCAACTGAAGCTCTCAGTTGTTTCAAGAATGCAAGATGGGGGCCAGGG
ATTTAGCTCAGCACTACAAGCACTTGCCTGGCTCGATCATGGGCTTGATCTCCAGTACCA
CAAAAAAAAAAAAAAAAAAAAAAAAAAAGGAAGTGCAGGATGGTACAGCCACTTTTGGAA
AGAGTTTGGCAGTACAACTTAAACGTGCATTAGTTAAGGATACAACAGTCTCACTCCCAG
GTATTTGTTGAAGATAAATAAAAATCTAAATCCCTACAAAGACATGCATGTGACTATTTG
CCACAGCTTTACCTGTAGAAGAGAAGAAAATGGACACAGTCTAAATATCTACTGTATTGG
ACAACTTTCTATTGTTTTAATAAATTACTTGATTCTGGGTACTTTATAAGGAAAAGAGCT
TTTATCAGCCTACAGTTTTAGAAGCTAAAACTTCAAGCTGTGGAAACCCTCTCTGGCCTT
TGTTGAGACTTTTCCTGGCTGCATAATAATGTGGCAGTAAAAAACATGTAGCCAAGAACA
ATTTTCTGGCATGGTCTTTATTTTTTGGTATTATTTTATTTTCTAAGAACCACTGTAACT
CACTCTGGGAAACCAGTATTAACCTCATCTGAGGGCAGTGCCCCCCAACATAGCTATATT
ACACCAGTTTGCACCTCTTTAAGAGCTATCACTTTCTTGAAGAAACTCGCGATTGGGAAG
TGGAGGTAAACCTTGATATCCTGAAATCTTGATGGACTCCATTTGCCTACAGCTTGCCCT
TACAAACATGAGAATTGAAACAATCTGCACTGTTCCTGTTCCAGAGTACGGGACGGTCAC
ACCTCAACTGAAACCTTCACTGATTACCTGATGATGTGAAAAGATCTGATATTATATGTT
CCCCAACTACAATGAGTTGATATCCGCAAACAGGCATAAGAGTGTCTTTATGGTAGGCAG
CCAAATGAGTGCTCATTGAAGAGAAGATTAAATATGTCCATTTTTAATAAATTTGTGCAA
ACTATTAAAAAAGAAAAGAAAAGATTCTGCCACCTCCACACTGTGCCACTGTGGACCAAG
CTTCCAGCACACAGAATCTTTGCAGGACAATTCTGAGGGCCATTCTATATAATGTTTTGG
GGAAAATTATTTCATAATTAAATTGTGATTAGGGCTCAAGGCCCAGTGTCTTGCTATAGG
AGCTAGCTATGATGTGTGGAAACAACTCTGTGTGCCTCCCATCACACCTGAGACCTAAAG
GGTCCCCTGAGGCTGTGATGCCTCAGGACAAGACTGCATCCGGCTGAAGACATCCTGGTT
TCTTGAGAACTGAGTGGTAGTTTTAAAAAATGTTTCATCTTGGGAAAAGGACAAACTTTT
CATTTACCTACCACCTTTCCCCACTCACCACATCAACATAAATATCCTTCTTAGCATGAG
ACGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NACTTTTTCTCTTGCTCTTCTTCTTGCGTGTGCCGTTAATATCTTGTTGGAGATTAGGGT
TCACTGCCGGGGTCCCCAATACAAACCACATCCAAATTGTATCATCCACTAAGTGCAGAA
AGAATGGAAAAACTATGACCCAGCCGTACAATGGAACAATACTCAACAATAAAATGGAAC
AAACTATTGATTCATCTGACTACACATATAAATTTCAAAAACATAGTGTTAAACATAAAA
AAGGAAACTAGACTCTATGCATAACACCCTGGAAAAGGCAGAAATAAGAAAAATAAGTCA
GTTGTTCATAGAGCCTAGGATAGGCTTATGGACTGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved