Cavia_porcellus Locus Mono:SNORD49
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORD49
Cavia_porcellus
Mono:SNORD49
scaffold_60
SNORD49
1001..1052
2052
AGTATTGTTTCTTTGCAGAGCTCACATGACTTAACTGTCTGCTGTATTGTCTGAAAGAG
TCCCTTTCCTAGGCAATTGGGGGATCTTGTCTCTCCCCAGGTGAAAGGTTTGACAAAAAG
ATTTCATTTTCCATGCACTAGCACCAAGAAGGAACAACTTACCATCATCTGACTGTAATG
ATTCTGATGGAAAAAACCAATACCCATGGGAGAGCACACTAAATATCTGACAGACTATTT
GGGTCAAGTATAATCAAGGGGCCCTTCCCAGATCAGAGGGCCTGAACATGGGGCACCTTG
TACAACTTCTTTTGCAGCTGCATTAGCCAGTTTATTACCTTGAGATACTTCAACTCCTTT
TTAATGTCCTGTACAGTGAGGAACCACCACTTTGGAAGGCATGCAGGCAGATGATAAAGG
ATTATCTGTCACTTTATCATACTTTATGGGAGAAACGTTGGCTGTCAAATAATTTCTTTC
TTTCCATATGGCTTGCAATACTAGGAAAGCATAATTTTGAATTGATAAAAATAATGACTT
TTATCCTTCACTAAGTTGCAAAGCCCTTGGCATAGCTATGAGTTCTGCTAGTCGCATACT
AGTCCACGGGGAAGTAAGGGAGTTTCGAGTATCTGATGTAAAGTCAGTACTGCATACCCT
GCCTTTCTTGTCCTGCTTTCCATGAAGGAACTGCCATCACAGAAGAAGGTCAAATCAGGG
TCAGTAAAAGGTGTGTCTACCTAGTCTCTTCTGGCTATGTATTAATGGAAAATCACCTGT
TTGCAGCCATGTCTTTCAATATTAATTCCATTCTTTTTTTGGTAGAAAGTTGGCAGGGCT
TAAGGAGGAAGATGTCTTTATTTGAATGGCTGGTCCTTCTCAAATTAGAATCTGGTATTT
AAGAAGTCAGTTGTTGGATAATCACAGGCTCCCTTTGGAAGAAAGAAGTCCTGCCCCATT
GTGAGGTATGCATATAATATCTTTGCCTAAAGTCAGCTTGGTGCTCTGATGATATCACTG
ACAATAACTGACAATAACTACTACTGGCTGACTGCAGTCAACAAGTCCATTGCTCTTGCT
GCCAAGGATTAAATTGATCTGAACTGTGACAATATTTCTATATTCACTCAAGTTGTAAAT
TGGCAGGAGATACTAGCAGCTTGGTATTGCAGCCTGGAGTATTGGCCTTGGGTCAGGTTT
TGGGAACAGTGTTGGAGTACAATTTTAAAATTGGCAGCAGTACAGAGCAGGAGGAGGCTA
CAGACCCAAAGCTGCCATTGATTTGGTTTGGAAATCTAAATGACTTGAACATTTGGTATA
GAGGAGACAAGCTTATCTCCTAAAGCAGAGGACTTTCTTCTCAAAAGAGCTGATGTGTCT
GGCAGTTTTTCATAGGACAGGCACATTTGATGTCTTTCATTAACCTTCTCAACAAAGAGG
AGTTTTTTTATGTCTTCATATAAATTCATGCTTACAGATGTCACTATTAAATACTATTAT
AGTAAAAATAAAGTCAGGTTGTATTCTTCTGGTACTAAGAGAGCTATAACAACCACAGCT
CTCAGGCAATGATGTCTATTTGGATTTTATTAGACCAGGTGTTACCCCTTTTACCTTGGG
AAGATAGGTAGGCCTAGTCATTCTGTCTTTGTCTTGAGGCGTGGCCTCCAAAAGATACAC
TTCTAGCCACATTTGTAACGTGTTTTCATTTTTGGTATTGACTGTCTCAAAGGCTCAGCC
TTGTGTGACTGCCTATAATATTTCTACCTAATTTAACAATACTAGGATCCTGTTTTGTAG
CAAAGTGACCACTGTTTCATCTTAGTAGCTCTAAATTTTGCATCCAATGAAGCTTTGCAA
CTCTGACATCAAAAAGAAACAAAACAGCAACTTAGATTTTAATGTAAAAGTTAATACGTA
ACATTAGTTTTAAAAGGTAAAAAAATTAACATATTTATTTTATAACAAGCTCTCATGAGT
ACTTTGGACCAAAGATCTATGTTCTGTGTGACTTTGGGATATCAGTTATGTTTCTTGGGC
TTTACTAATATAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved