Cavia_porcellus Locus Mono:611:SNORD15
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:611:SNORD15
Cavia_porcellus
Mono:611:SNORD15
GeneScaffold_5822
SNORD15
1001..1126
2126
GCCGTTTCTTCCTCACACTCAGCTCCTAAGACTTTGGTGTAGGTTTGTTTCCCTCGTGC
CAAAAAGTTGTGAGGTGGACACAACCAAAAATACCTTTTTAGTTGTTTCTGATTGTTTAG
TTGGGTTTAATCACTTATTATCTGGTTTCCTGCACTACAGGGTATGTTCCATGAAGTCAG
AAAATTTCTCCATTTTATATGTCACTGTATTCCCAGTATATGAGACTTGTTTGGTACATA
GTACTGTAGTTACAAAGAACAGAATCTGAACAATTTGGTTTAATTATTTTATCTATTTTT
ATATTTTATATATTGGTTTATGTTTATTTTTATTGTATCAGGAATCTAACTCAGAACCTT
GTGCTTGCTAGTTCAATGGTTTCAATTGGCTTTATTTTTTTTAGCCAGGCTACACTTCAT
TCCATAAAACAGAAGTATTCCAATGAGCTGAGTGGAAGAGTTTGGTTTTCTCAAAAGAAA
AAAGAAAAGGGCTGAAGAAAGCAGAAACAGAAAACCTAAAAAGGCAGATTGGTCATTGCA
GAATTACTTTGTAAGGAAATATATAAAACGATATGTAACTTTACTTAGTTAATTCTATCT
ATTTGAATTTATTTTAAGGAGCTAACTGTAGGTGAGAAATGATATGCATAATAAGGGCAG
TCACCTTATTATTTATGGTAATAGAGAGCACAGCTAACTAACCACTAATGTTACATTATG
CTAAGTCAAGTAAATGGATATTATGATATATAGATTAGTATGAAAAAAACTTATGAAATA
GTGGAGAGTGGAGAAAATTAATTCTGCAACAGCATACATGGAATGATTACATTCTAATAA
GGTTTGATCCAGTTCTGCTTGTATCTTTGCATATAGTAATGCATGAAAAGATATTTGACA
AAATATTAACAGTGTGAGGAAGTGGGATTTGGGTGACATGAGCAAGATTTGGGGTGATTT
CTCCTGACCTTTGTATATTCTTGTTTAATTTTAAAAACAAACTTCATGATGACTTGCTGG
GAGTGTCATCTCTGTCTCTGTGGCCCTTGCTGTCCTGTATCTGTGGTATAATCTCAAGGT
TCAAAGAAACTTCCAAAAGATAACCTGGAGGCATTAGTCTAAGAAGGGTGTAAAAAATAA
ATACATGAATTCACACTTTAAGCAAAGCCAGTAGAACTCTTCTGCAAGTGAAAAGTGCTT
TTCAGAATTTATTCTATTGCACTCTATGTCAAAGTGACCATACTTCCTGTGGAAGGCTTA
TCTCACGGTGCCCACAGCAAGGGTCAAGGGTTGTAAGGCTTTGCAAGTTAGAACCCTATC
TGATCTTGCAGACCAGATAGCAGGGGCCTTCGAACTGGTCTCCCTGCCCTCTTCTGCCCC
TCGGTCCAATGCAGTGGGCTATAGCAGCATCCTGTGACTCTTTGGAGAGAGTCCAAGTTC
AAAGCTGCAGTCTCAGTCTTCCACATGCACTTCTCAGCTTCTGTTTCCAACCCCATCCCA
GCCGCTCTTTTCTTCACACTTCATCTGCCAGGTCTCACTGCTCTTCCTTAGTCCCTAATG
CTTGTCTTTCTCTTTCTCTGAAATTCCTTGCTCTCCAGCTCTCTTTCACTTGAGGCCCAT
CTCACAGATGAGGTTTTCACCTACCCCTGGAGAAGCACCTCCATAGAAGTACCACAGTAG
TATCTACTTACGCCAGCACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAGAAGACTCTATGA
TCCTCTCCCTTTGCACGCCACACTTTTTTCTATTGAGCACCCCCATAATTCAATCATCTT
CCAAAAGTCCTACCTCTGAACACCTAAGACTCTTGGGGGACATCTAGATCCAAGTTATAA
CAAATTTTTAAAAAATACCTAAGTTGGCATGGTGGTGTGCACCTGTAGGGCCAAGTGCTT
GGGAGATTAAGAGAATTCTAGGCCACT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved