Cavia_porcellus Locus Mono:72:SNORD52
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:72:SNORD52
Cavia_porcellus
Mono:72:SNORD52
scaffold_165995
SNORD52
1001..1067
1313
CTTTAATTTGAAGGTTTTTTTTTTTTTAAAGACAAGATCTCACTGTGCAGTTCAGGTTG
AACTTGAACTCACTTTGTAGCCCAGGCTGGCCTCAAATTCACAGTGATCCTCGTGCCTCA
GCCTCCTGAGTGCTGAAATTACAGGGCTGCGCCACTACACCCAGCCCTTGTATGCAGAGA
CAGTCGTCTTTGCATGTGCTAGTTCTCTTCCTTGAATGTGTTCCCTTGATCCAGATCTCC
CTAAATTGGGAATGATGATTTCACAGACTAGAGTCTCTGACACTGGTTCTGATGTCAAAA
ATAATGTCTGACTCAATTTAGAGACCTGGATGTGTGGCTCTCCGAGAGGCTTTCGCAGTG
CTGTTCTTACTAGTCCTGTTTTCATCTTTCTAGCATGAGCACTCTGGAACCCCAACCAGG
GGCAGAGCCCCTTTCCAGAAATTCCACACTGACCTGATGCCTGGAAAGTACCCCTCCCCC
GACTGTCAGGGCTCCAAAGATGCCTAGGTAGCCTTGTCTCCTCGGCAGGCTGTGACCTGT
GGAAATGAAGCCCCCTCTGGGTACTGCGGTAAGTATCACTTTGGTTCCGGGCCTCAAGAG
TGGGAATGATGACCTGGTTAGACTAGAGTCTCTGAGTTTCTTTGAGGATATTTGAAACCA
CCTGACCCATTCTTGGGCTTCCCCTCAGTCCTTGACAGCTCCCCAACGAGCCAGCTTCGT
GTTTATACTGCTGCTTGCCTGCATGGTTCTAATGTGTCATTTTGTGAAATTTCAGGGTTT
TGCTGACAAAGGATGTCTCCTGTCTTGGGTTGGCCAGATCCCAGGAGATCCACATCATTC
CCATGGTAACCCTCTGAGCGCTGTCAACTTATTGGGCAAAAAAAGCTGGAAGTTTTGAGG
CACTTTGTGTTAAAGTAGAAAAGGTTCACTTACATTTATTTTGTTTTCTACAAGTACCTT
TTATCAAGACAATTCCCATAAAGTATTTTAAAAATAAATAACTAGTGGATTATCTGGTCT
TAAGGGAGAGGGATGATACAGAAGAAATTAAAGTGAGAGGCAACATGCCACCCCTTGGAT
GATCATTACGATTGAACTCCAGGTGTGCTTTATTGCCACGTGAAAATGCTAAAATCAATT
TATTTTGCATATTTAATGCTGACCTTAAGAATTTCTAGGTTTTGACAACTGCTGCTATAC
TGCATGTTACTGACAGCACAGCATTTAAGGTTTTCCGTTCCGGTGACCTGTATTGTGGCA
CATAAATAGCCTTGTGACTGGGAAGGACTTGGTACTTGTTCAATGCTGCTGTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved