Cavia_porcellus Locus Mono:485:SNORA11
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:485:SNORA11
Cavia_porcellus
Mono:485:SNORA11
scaffold_278558
SNORA11
1001..1124
2124
GCTGGGTTTAATGTTCGAATTTATCTTCTTTTTGCCGTGATGTCATACCGGGTTCTCTT
TACAACTTTACCTAGTTGTAACGTTCAACATCTCATAAATGGTGAGCTGAACACGCTAAA
TTCATTGCTCGGCTGGAAAGCTTCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAAACTCCACTCAGGTAAAGGAGTACAGTAAATTTATCAGTGAAAATTTGTA
ACCAAAAGCAGTATTGATAATGATGGAAGAAACAATATCATCATTCCCTGAGATTTCTCT
GAGACACGCTGAATGTCACATCAAATCCAGCACAAACATGCCAGTGAAAGAAGTAGCAAG
AATTAGAGCAAAAATTAATTCTCATTTTAAAAGCAGTCAGTGGTGTGTGCTCAGAGCCAG
TGGCCTGAAGAATGGCATCTCTGTGCACAGCACACCCAACAGGAATCTGGGGTCATGTGA
CAAGGGGCCAGAACCTGTGACCTCCTACACTTGTACTCATAGGCTCCCACACAGCTTTGG
GCTAGCACCACAGGACCAGGCTCAGTGATGGGGAAGCCACAGCATTTAGGGGGAGGGGGA
CATTTTGAGTGTGTCCATGGGTAATCTGTTGATAGTTCTATAAGTAAACACTTTGAATTT
CTATTTTCAATAAAATTAAAATAATACTAATAAAGCAATGAAACAAAGAGGAAATCAAGA
AAGGAAACTTCACCTTTGAAAAGATACAAAATTCCAAAAATCTTAGTTAAATGGATGAAA
GAATGAGAGAGAGAAATACTTGAATAATTAAAATCACAAATGAAAGAGATTTAAACAACC
ACCTAGAAAATATTTTTTTAAAATTACAGAGAAGTGATAATGACAATACATGCCAATAAC
TTAGATATCTAAAAAATAAATAAATTCCAAGAATGATACAAACTGATAAAACTGACTCAA
GGGAATGTAGGAAATCTAACATAAATCTATAAAATACCAGATTATTGATTGAATAAATAT
TTTCCCAGAATAGAAAACATAGACGAAATGGTAGCATAGTAAATTTTACCAAAAAACCTA
CATTCTGCAAAATAAGCATTTCTGTCCTTTTCCAAAACACTGGAAAGCGTGCCATAAAAT
CTGCAGACCGGGGGCTGGGGATTTAGCTCAGCGGCATAAGCACCTGCCTTGCAAGCAGGC
GGTCGTGAGTTCGATCCTTGGTACCAATAAAAATGAAAAAGACAAAAAATAAAATGAAAT
AAAATATTAAAAAAAATCTGCAGACCGACTCCTCTCCTTTATGTCTTAAACACAGCATCG
ACAAATTGAATCAAATTGCATTAATAAAAGATTGTACTCCATTACCAAGTGTAAGGAATC
TCTACGAATGCAAGGTTGGCTTTGTAGGCAAAAGTCAGTTAGCACACAATAGAAATGGAA
AAGAATGCATAACAAAAGAAAGAAGACTAATAAAAGACAACAGATTCATTATCATCTCAA
TCTAGAGGAGAAAGATTTGCCCAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved