Cavia_porcellus Locus Poly:8:SNORD50
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:8:SNORD50
Cavia_porcellus
Poly:8:SNORD50
scaffold_237791
SNORD50, SNORD50
1001..1070, 1281..1350
2350
ggaaatggtggcgcaggaaaaagtttggacctcagtgctctgatgtcggttttgagccc
agggtgttgttgagaagttgcttacagcgggcagacacgtgtggagctgaggctggggag
gttgggccgtgcgctgccggcagcgctgagtaactgccagcgggaaagctacgcttaggg
atttggcgtgggaggttagttgaaaagcaacaagcatggagcggacttttggctcagcga
tagaagagcctgccggacaagctcgaggttgtgagttcgatttccgatacaaaaaagaaa
gcaacaagcatttgctaacacagacaatattttcatgtcgccaggttgtttcagcaggaa
taatcctgactttatgtcgtattcgaagctatttggttccttgacgacgttgtgtacaat
tcggattaacgaatgggaagggctagtgctgaaaacaaacactgagttctgtaatgttta
atttcaaacagcgcatccttgcaggagcaatgtcgccgttttgcagagatgcagagaaaa
gtttacgtacaaatgccaaggtaaaaactaagtttttcaaactaaaagggtaagcttcgt
tacgagaatgaaaaatgtgcatcatttgaaattcgcttttctttttttaatagttgcatg
agaaaattccaaaggatctgccagaatcgtcagtgaaaaaatacgtgcacaaaacttgac
agtgaccacaggtgtgtactggacctagtgttaatgattaagcatgtggttccgtatttg
aatgtagactacatgaaatttttgtcgttgaacagtgtcttgggtgttgatacacaacag
tgaagctgtacatgttactggccagctgtttcattttaagtaagttatgtggcttagaac
ttatttctaatgtaaaacttgtgatggcgtttcccatgctagtaatggaaccaagggtgt
aagtctagtcagtgatgaaacctatcctgaaaatttggtctAATCAGTGATGAAACCTAT
CCCGAAGCTGATTACCTGAAGAAAAACATGCACGGATTCGGCTTCTGAGATaagaccaag
atttataaattaaataataaacttagatttttatgatggttctgttcgtaacaactcaaa
atgcttgatctttttcaggctgtagtgagtgttacaatgtgtccagaggctggcttgcag
gaaactgccgaatgtggattgatttctgtgagtggagatgaggggagagggcataattcg
cacatattgtgtttttggtcaTATCTATGATGATCCTATCCCGAACCTGAATTTCTGTTG
AAAAAACATTTACGGATCTGGCTTCTGAGATtgaccattataaggactagttatattttc
aagtactgttgaattgtaacaaacagttataatttttgtgtttttccttttctagggtta
atgccataagtttctctgttgcatgaaaagctggtgtgaacaatcaggaaagcatgaata
aaagttgagtgtctactgattttccttcttttggtattggagattggctttttatatgct
aggcaaatagttcagtggtagaccacaaaatagcatgggcttctttaaatggaggttctt
ggctcttagctggccggcctttaagaaagattacatctcaattaccaagactgaggctgg
acttcattcttctgtcagaatttctcagtgtaggattagctaacaagcctttaatcatct
gtttggattcaagtgttccagttaaacctgaaattttttaccaaatcatggtatgtggca
tttttgtaaagctatcccaggtggtcactgagtgactaccctactcctggaatgttgagc
cctgatataaaagatgctgtgaaaggaatggaagatcaaaagtacagcacaacaaagttt
cttattagataaatcatatgtggatttaatatatgaaatttctatgaataactttggtgt
cctgtcttgtttaaatgtatgcactaaagtgttcatcaaagaatttcctgaactgttagc
tccttgataatatatgctataattccttgcccccgttttagtgcccattgatcagcctca
tcccaacacctaccgcgtatgagaaatgcaggttctaggcccccccgttccagctttgtg
agacagcaccatacttcttttatattctgtttttgaggcagtctggctatgtagttcagg
ctgttgaactgccagtctccaaagtgctagaataacaggcatgtgccatcactcacctat
gccatacctttgcctagagtttcattcaacatgaggtcttaagtttccatccatgttaca
agtggcaagaa
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved