Cavia_porcellus Locus Mono:473:SNORA36
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:473:SNORA36
Cavia_porcellus
Mono:473:SNORA36
scaffold_118272
SNORA36
1001..1119
1207
TTGCTCTTCTTTTGGTTGTCACCGCGTGTCCGGGGGTTTACCTTTTTCCCCTTTCTTTC
GAAACGACTGGTGTAAGATATTGGCCTCGTCCCAAATTTTGACGATCAGTTCAGGGTATA
TTTTCTGCTCTGGTAAATTAAACTTTGAACATGAAACTGGGAGAATGTTGGATAGAAAAT
GTTATTCTATTCATTTATCCCTAGCTAGAGGATAAAAGAAAGAAAAAGGAAGGAATAGCC
CAATAAGGATTTACATCCACATCTACTTGTATCAAAAAGCCTGCATTGGTTCTGTTAGGT
GGCTCCATCCTTTGGAAAGTACACAGATAGAGACAATGGGTCAGCCTAGAACTCATGACC
TGGTAACATTATTTGCTTTCTTTGAATAAGGGAATAAGGAGAAGAAACATGAGTCTACCA
CTGTGCTGTGAACTGAGGATTAGTGAAGGCAGACATTGCATTATTTTAAGCTCAATGTCC
TTTACTGGACCAGCCCTGAAATGAAAGGATAGGAAAAAAGATGTCTGCTCTGAAATGGGG
GTGGAAGATATTGTACTTCACTTGTCCATTAAAGTTAAAAGTATAATTAGTCAGAGGAAT
ACTTGGATAAAAGAAGCAGAGACAAACAATGTAAATATGAAAGAACATGAAAAGGACCAG
GACCCAGAGGATGACAAAGATAAGGGACACATAGCTCATTGCCAAACTGGGGTTATTTCT
ATTTAGAGAAACACTAAAGTCTTTCTCTAACCCTTCTCCCTTAGTCTTGATAATGTGAAA
TTCTTGGGGCCATTCGTACTAACTCTGTCCCTTTTATGGCTCTCTGTATAATTAGATCCA
ACCTTTTAAGAAAAGGGTTCTGGCAGCTATGTCTCATGGTTTATGCATGACCCAGTTCCT
TTCATGTTTCCTGCTATAAATTTATGCTTGTAAATTGCATTTTTGAAACCCTATTGTTAC
CATTCCTTGGGATAGGAAATTTCCTTTTAATGAGACTAGTTAGCTGATGTTTTGTGGAGT
GCTTAAAGTATACTGGAAGAAGGGCCGGAGGAAGGACTGTGAAAGGGCACTGAGAATGTT
AATGAAAGTAATAGTGTGTGGCAGTTTTTGGTCTCCAATTTTCCTTCATCTTATACCATC
CATAATAGATTGTTTTAGGATCTATTTAGGATCAAAATCAGTAGAACAAATGGATAGATG
GATGGATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved