Cavia_porcellus Locus Mono:523:SNORA77
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:523:SNORA77
Cavia_porcellus
Mono:523:SNORA77
scaffold_236402
SNORA77
1001..1129
2129
TGAGGAATCTAGAACTGAGCTAACATGAATGTTAAGCCAGTAACTGAAGAGCTGCCAGT
GAGGGGACTGAGAGTACAGACCGGGATCTGCAAACTGCTGTCTTCAGGGGCCAGAAAAGT
AATGACAAACTTTAAATCCCCAGAGCCCAGCTGAACAGCTGCTTCTCCCAAGATCCTGTA
CAAGTGCCGATCCCCAGCCCTTGAACACAGAAGCAGCTGCAAAGCCTGGTGTGTCTCCAG
CACTTGTGCACATCTGCTCTGAGACAAGGACGTACAGGAGGAGAGATGCAGCCAGCTGGG
AAGCCCTGGTGTGTGCCATGGTACAGATGAAGTGCTCTTTGAAAGACAGTGAAAAGTTGT
TGTGCCACCAGGAGCAAGGGATATCACCTGATACATGTGATGAGAAAATGGCACGTGCAG
ACTTAGGTAACTCCACTGCTTCCCATCTGTCTGTCTGTCTGTCTGTCTGTCTGTTTGCAG
GGTGAGGGCAAGGCAGAGAGAATATGACCTGAATGAGTCTGGAGCTGTGGGAGCCAGGAC
AATCAGCCTCCACTCTCACCCGAAAATCAAGAGCCTCTCAGCTGAAGGCCTCCACTTCCC
CCTTCACCTGGGCACATGCATGCACATACGGACAAGCCCAAGTCTTACTGCACAGGGATG
GCAGTGTCCGTTCCACACGGACTTCCCACTGTCCAGGGTGAACTCTTCTGAAGGGCCGGG
ACATAAGGAAGGTTCTGGTAAACTGTGGATGCACCCTTCACTCACCAAGTAACGAAAGGG
TCTATGGTCTTTGAAACAGAACTTAAAACAATTACTTTTTTTTATTTTGTAAGAAATAAA
ATAAGAAAGCTAGCCGTGGTGGTACATGCCTGTAATCCCAGCACTCAGGAGGCTGAGGCA
ATAGGATCACTGCAAATTCTAGACCAGCCTGGACTACGAAGTGAGTTCAAGACCAGCCTG
AACTGCATAGGGAGGCCCTGTCTCAAAAAGACCAAAAAATTGCAGACTCACTCTGCACTT
GGCTGTAGCCTCCAGGCAGGTACTTTTTCTGTCTGCCAGAGAACCACTCCAGGGAGCTGT
GACAGCCTTGACCTGTCAGGGGGGCAGTGCAGCTTCTTGGGGACATAGAATGCTTCTCGG
TAGGCCCCCAAGCTGTGCTCATTGTCACTGGTCTCACACCACTTTAGTGTCCAGGTAGCC
AGTTGAGTCATAACTCTCTAGAACCTATGGTAGATACAGTCTCTTGCTCCTCAGATGGTG
ACTGCTATAGAAGGACTGGGCAAAAATGATAATGCGGAAAAAGTAGCTGAAAAGCTAGAA
GCTCTGTCTGTAAAGAAGAATAAGGACCCTGGAAAAGAGACCGAAGAGAAATCAGAGAAG
CAATGAGTCTTTCTTTTTAAAATTTTGCCCTCTCCTTTCTTTTTGTTTTATTTTTAATTC
TGTTTTGTTTCTACGAGGGACTTTATATAAAGAACTGAATTCCAAAAAAAAAAAAAAAAA
AAAAGAATGTGAATGAAGAAGCAGGGGTACAAACAAAGGAACTACAAAGGCTATTCACAG
AAATAATTAAGGAAAACTTCCCAAGCACAGGAAAAGGAAATGATATTCAGATATATGAGG
CATACAGAACTCCAGCCAACTACAACCAAAACAGAGCTACACCCAGGCATATAATAATCA
AGATCCCAGAAATTCAATATAAGAACAGAATATTAAAAGCCGTCAGGGAAAACAGATCAC
CTATAAAGGAAAACCCATCAAAGTCACGCAGACTTCTCAACATAGACTATCAAATCAAGA
AGAGCTTGGAGTGAAGTATTCCAAGCCCTGAAAGAAAATAACCTCCAATCTAGACTAATG
TACCCTGAAAAACTGTCTCTAGAAATTAATGGAGAAATAAGATGCTTCCAAGACAAAGAG
GAACTGGGGGAATTCGCTACCACCAATCCAACTCTACAGAGAATACTGAAGGACATTCTA
GAGAGACAAAAAAGTACCAGGATTCTAGGAACAGTGGCAGAGAGGCATCAATGAATGGAG
CAGAAAGTGGAATGAAGAAAGAAAGCAGACAACTGATGGCAGAAAAAGAGCACAAACAGA
AATTGAGGCAGAGGAAAGGTTGGGTTATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved