Cavia_porcellus Locus Mono:178:SNORD30
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:178:SNORD30
Cavia_porcellus
Mono:178:SNORD30
scaffold_261856
SNORD30
1001..1070
1770
ACCTGCCTTACCTCAACTCCTAGCTCCCAGAACTATAGGAAACAAATCTTTGTTATTTT
TTAAGCTACCCAGTCTGTGATATTTTGTTACACCATCATGAACTGATTAAGATAGAGGTT
GGCATCAGTGAAAACTGAGATGGTGCTACTACAATATTTTGAAATGTAAGGGCAGCTTTG
GAACTCAGAAACAAGTAGAGGTTGGAAGAGTGGAAATACATGCTAAAAGAAACTCAGATT
GTTGTAAAGAGATTTTTAATGGTGAACTAATGATGGTTCAAAAAGGAAAGAGAAGAGATG
TAAAGAAAAAGTTTACCTTACTAGAGGATACACAAAAAAATCATAGACAGAATGTTAGTA
GAAATGTAGATTGTAAAGTACAGTCTGATGAGTTCTTAGCTAGAAATGAGGATTCTATTA
CTGAGGAACAGACTAAAAGCCAAACTTTGTTTTGAAGTGACAAATAATATGGCTGAATTT
TATTCCTATGTTATTTTGTGGAGATGTATATTTTACTTTATGAAAAACTAAATCAAAATT
TCATAGCAAGGTAATATAATAACAATAGTTAATACATTTTACAGTGTTACTTTAAAGTAG
TACTCAGAATGCAAGATAGAAATCAAACATATTCTTATGAAAAACAAGCCAATAATATCA
CAGAACTTTCTTGAAGGTATAATTTTAAAAGATGAAATTGAGTGTGTGATGACTTATACG
GAGTTACATTTGGCTGATGAGTTGCTGTTGAGACTTGGAAATCTGATTTGTTGGGTATAA
TAGTTTAGGTGACAATGCAGCATGTAATCATGACTTACTTCATCTCATGCGTTTGAGATC
CAACACCTTATTTAGAGGCCAGGACTGACTTTAGGATCTCCTACGTCATTCAGACTAGCT
TTGAACTCACCAGGTAGAACAGACCTGCCTTGAACTCACAACAACCTCTTTGCTTCAATC
TCCTGACTGTGGTTACAGGTATGTGTCACCATGCCCTGTGCAAACCATGTTTCTTCTCAG
CTCCAAGACAAAACAAGAGGCTTTGGGAAAGAACACAGTATATACAAATGGCGTCACAAG
TCTTGGAGAATAGCAGGAAGAATATTTCACTCTGGCTATTAAACCTGGAATGTAGTTGTT
CCCATATTATTAGTAAAGCTGTTTTCTAAAAAAAAAAAAAAATGATGCAATTGGATGTTA
CAATTAGCTGAGAAGAATCCAAAGCAAAATGTTAAAATGATGCTTTTGATGCTTTCTGAT
CATCTATAAAAAAGGAACTATAAATTATAGGTTGAATGATTAAGCAAAAGGAAAATAAAT
CTTAAGTGATTTGAAAAATTCTCAGCCTATTCATCTCAAAAAAAAAAAAAGAAGAAGAAG
AAAAGAGAAAGCATGTTTGGGGAAAAACACTAAGGTCATAGCCATGAATCTGTGAAATGA
AGATCAGCACATGTGTGAAGCACAGACTCAATTGGCAATCCCAGCAGGTGATTTATCTGA
AAAGAAAAAAAGATGGGGATTGTGGGGAGGCTGCTAAACTCTTGGATCTCCCTAGATGAA
TCTCTTCTGCTTCCAATGTGTTGTCCTTTGCAAGTCAAAGGAAAAAGAAACCTAACAGCA
TTTCATGGATTAGCATTGCCTTTTTTGTGTCAAAAATAGTTTGGAACATTTCCTTACTTT
GGATAGACCAAGTGACTCCAAACAAAGATCAGGGCTGGGTTTTCCAAAGCTGTGGGAGTT
CTGCTCCTGCATAGCAGATATGTGGAGGTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved