Cavia_porcellus Locus Mono:SNORA40
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORA40
Cavia_porcellus
Mono:SNORA40
scaffold_12
SNORA40, SNORA25
1001..1129, 8055..8184
2129
ATTTTCTATTTAGAATTTATTTATTCCTCCCTGACCAGCAATTTTACCAGTCACACAAA
TTTACAACCTATTTATCAATCACATATGTCAACTGAGACAGTTTTGTACTCTTTATTATA
TACTGATGATTTCATGGCAGTCAAAGGGGTAAATATTTCAATTAACTTGTGATCACTCTG
TAGGATTTATTATAGAGAGTAGTAATATTTTATGGTTTTCCACAAACAGTAGTGACCTTT
GTATAATTTCCTATTGAAAAAAAATGTAGAAAAAAGATATAAAAGAACATTTTCACATGT
TGAAAGTTATAGAACAGATCTCTTTGTTCAAATTAAAAGCTAGTGACTTTGTATATTGAT
AGTAACTATTAATTACAGACAAAATAGTTTAAATAAATTTTATTTATGAAAGAAGTTAGA
TTTTTGTCACAAAAATGATAGACTGATAACTAAACATGTATATGTAGGAATTCTCAAATT
TATTATTATTTAAAAATATTTTCAAAAACTGAAATAAAATTTTAATGAGTTTCATAATCA
GTTGCATGTGGGATATTTGGGAGAAATAGCATCAACTTAACAACCCATAGTAATTACTCA
TTGGTATATTTTAAGAATTTATATTGAAATAACGAAAATGCATCCTTTTGAGTTTAATGT
CTGTAATTTTTTTAGCTTCTTATTTTTATACTCTGTCTTTCAAGACAGAACTTACCACAA
AACCAAAACAGGTAACATTGCTTTTCATATATCTGTTTAACACTGTGACCCTGGTTTTAA
GATGCTTATCTCTTGATGTTTCAGCCATAAGGTTATGAGCCTTTCCTTTTTCTTTCTTTA
TAAAGTTTTCCAAAGCACTTAGTGTCCTATGTTTGCTGTATAATTTCTCCTGAACATCAG
TGGTGAATGGTTTGCCATCTGTTTAGGCTGTACAGGACAAACACCGGTAGTCAATTGTTA
TCTTCAGGATAAGATTCCAAATACAAAAAGAGATCAATCTTGGCACTTGTGTCTTTTTGG
TCTTAATTTGTAGACTAAAATTTCAATTTACTGGTGAAAAAAAAAAAATCCTCTTTTGCA
GCCCAGAACTCATTGTTCATATGAGTTTTGAGATATATATGAAAAATACAGCTAAATGCA
GTGGTAAAAGTCTGTGATCCTGAAACTCCAAGACAGAGCCAAGAGGAATTAAGCTTGGAC
TGTGTAGTAAGATTCTACCTCAGGAAACAAAACAAAAACAAAAATTATTGAAACCAAATA
CAAATTAAAGGTATAAAAAAGAGACCAAACTAATGTGTAACATAGTATCATTATGATGCT
TAAGGATACTCAGAAAAATTGCAAGTAGTATTAGTACCTCAATTTAAAAAATAATTCCAA
GGATAGCTCTTGGTAAGTGCAAAGATGAGATGACAGTACCATCCTCTTCTTCATAAAAAT
ATAATGCCCCCCTATCTAATCTGTTGGTGGAAGGGACAATATTTATTTCAGGAATTCTTA
ATACTTGTCTCTCTCCCCATATATTTCTATTACAAAAGCAACTTCAAGCCTGAGGCTTCT
ATCTCCCAGCCCCATGGCTGCTTTGTGTTTCACAATAGATTGGAAATATAATCACTAAAA
AATTATTTCACATCTGAGGATATTGTGAAATGAAAGAGTGCAATCATATTTATATAATAA
AAAGTAAGGAAAGCAATAAAATTCTATATGTTATATATCTTCTAAACCTTTAGGAAAAAT
ATAATAAGACTGATCAATTTCAGTAAAATTTTATTTTGGATATTTTATTACTGTAAAGAA
ACAGCAATCAAGGCCTGCCAACATTGAAAGCAGAAGTGGTAAATAAAATAAAATTGAGAA
AATTTGGTATCTAAAATATATGTATTCCTATTTATTCCAAACTTCTCTTCATTCAGTGGG
ACTGAATTTGAGATCATTGTATAATAGTAATACGAATCCTAACATTCCCAGCAAAATAGG
AGTAAATATAAGGAACAACATAAAAGTCATAAATAATATTATATTTTTACTTTAAAAGAG
AAATATCTCAGAAGAATGTAGATTTAAGACAATCTAATAGCTGTCCTGTGTTACTACTAA
AAATAAAATATTTTAATTTTTCTCTGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved