Cavia_porcellus Locus Mono:601:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:601:SNORA2
Cavia_porcellus
Mono:601:SNORA2
GeneScaffold_6564
SNORA2
1001..1110
2110
TTTGGGTTGGATGAACTTAATAATATGTGAAGCCATGAACCCAAGGACCAGATCTATGA
CGTATTTCAAAACCTTAGCAATGCCCAAGTGGTTTTGCCATCAGCCATGGTGCCTTTCAG
TATGCTTGAGGCAATCAAGCAGTTCATGGAGGGCTCCATGTGGATTCTTGTCAAGAAGGA
AGAGTTGACCCTGGAGAGTCCCACCAATTCCACATAAGTGAAGAATGAGAGGTGAAAGAG
CTGGATATCATGTAGGTTGTAAGCAACCCTGGCCACCTTCCAGACAATCTTCTTTGTGGA
CACGGGAAGCAAGGTTGACTAACTCTGAGAAAATGCATGCCCCAAGATCCCCACTATTTG
CCATGCATGGAGATAAAGGCCAAAATGAAAGAGCCATGACTGAGAGAGTTCTGCTCTGAC
GAAAGCAGAGCCTTGACTACCACTGGTCAAAAAGCACCAATGCACAGCAGATTTCTTTAG
TCATCAACCATGACTTTCTCACCAACAGGGAATATTGTATCCACAGAGTCACCATGGTGG
ACAATTTGGCCACAAGGGTACTGCAGGCAGGAGGATGCTGGAGACATTGAGATTTTCTTT
TTTTATTGTTTTTTCTTTTTGGTACCAGGGATCGAACTCACGACCTCGCACTTTCCAGGC
AGGCACTTACACTGTTGAGCTAAATCCCCCACCCCTATTGAGACCTTCTACACCTCCATT
GAGGAGATGCCCCTCTGTGTTGCTGACCTCGATGATGAGAACCCCCTTGCTCCCTAGTCC
AGGGTTCAATGCTGGGGTCTGAGGAGCAGCAGGAAAGGAAGGAGAACCCAGGAATGGACA
CCTTGTCATTGTTTATCGTTTTAAAACTTTTTTTTTATCTTTTTTGTTTTTATCAGTACC
AGGGATCGAACTCACAACTGCCTGCTTGCAAGGCAGGCGCTTATACCACTGAGCTAAATC
CCCAGCCCCGTTTTAAAACTTTTTTGAAAAAAATTCTTTGACTGGCCCTGAATCAAGGCT
GGCAGCTTCCTAAAGAGTTGTCTTTCTATGGTCTGTTGGTCATTTCAGAACTTGGGCAGT
GAAATGGTCAACTCATTAGAAAGAAACAGCTTGAAGCAACACCTGTGAGTGGCTGTGAGC
ATGGCAGGCTGTGGCGGTCCAGGATAGGAGCCACCAGCGTTTACTGGGACCCACACCATG
CTGGGGCCTGGAGCAATGGGAAACCAAGCAACCCCTCCCCCACTGCCTGTTTTGTTTTAT
TGAACTTCAGTATACATGAAAGTATGGACAGCTATTTTGAAGAGAACAAGAGGCTCTACG
ACAGCCATTAGTGACTTCCCTATTGTCTGGTTTTGAAGACCTAAAACGCCTTCCTCATTC
TGTTCAGATCAGTTTTATACTATGTTGTTTTGTGTAAATTCTCTGTATGCGAAGACATGG
ACAACTATTTGAAAGAAAACAAGAGACAATATGATAGATAGTGAAGATCTCAGGTCGTTT
AGCTTGAAATTTATATCTCATATCCTATTTTGTTCTGAACCCTATTTATTTATTTATTTG
TTTGTTTATTTATTTATTTATTTATTTTTGGAGCCAGGAATCGAACTCAAGACCTTGTGC
TTCCCAGGCAGGTACCATGCTGCTGAGCTAATTTTACCCTCTTCAAAATAAAAATTTAAA
AATTGAGTAAATGTCACATTTTAAGGCCAAAAAAGGAACTGTAAACATTTTAAATATCTT
TTACTTTGGCATAGGCTCTTGCCTAAAATGTTGTCTCTTCTTCCAGAAAACACTAATCCA
ATTTCCCTCATCTAGTTACCTCTTCGTCCCAGAGGTACCCAACCCCAGGAATTTTCAATT
CCTCTGAAAATAACCAAAGAGCTATCCTGTCACTCAACTTCATCAGTCTGACCAAAAATG
AAAGGAGAGGCTGAGAAGACAGCTCAGTCACCTCAGTACACAGGGCACCTGTGTACCCCG
TGTGAAGCCTTGGGCTCAATCTGGGCACTGCCAGAGAGAGACAGAGACAGACAGAGGCAG
AGAGACAGAGGAAAGGAAAGAAAAAAGAAAGAAGTGGAGGAAAAGAGGGAAGAAAAAGAA
AGCAGAAATAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved