Cavia_porcellus Locus Mono:491:SNORD14
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:491:SNORD14
Cavia_porcellus
Mono:491:SNORD14
scaffold_295056
SNORD14
1001..1091
2091
GATGAGGTAAAATTTCTTAGAAAAGGCTGCCTCCTCAGGGTGTATTAAGTACCCAGATG
ATGATTAAAAATAGATTCACAAAGAATCTTCATCACTGTATACATGTGAAATTCTTAATT
ATTGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTGTACAGACATC
TTTCATGAATTTTATGCAAAGCCTGTTTATTTCAGGTGGTTCCACTCCACCTTGCAAACA
TGCCTACTTGGATATGTCCCAGAATTTGTTGTGGGAAAGGAAAATAAAGCTGAAGAAAGC
ATACTGATTTTAACTTCCTTAGCCTGGAAATGATGTGTGTCACCTTTGCTCCCCATTCAT
TGGCTAGAACTTGGTCTCAACCTAACTGCAGGAAAGTTGGGAAATTTATAGCTCCACTTC
TAAGGACACAATACTTGCTGTTTTGCATACAAGTATTTTGTTACAAAAAGAAAATCCTAC
ATATTTTTTTTTTAAAAACCCAAACTGATGAAAAGAATTAGGAGGCAAAATGATTTTGGG
TTTCTCAAATCCAATAGCAAAATTAGAAGTTAGAAAGCAATCAGGTAAGGACTTCAAAAT
TTTCAAATCGAGTTAACTTATTCCTAAATTTCTACACTCAACCAAATTATCATTCAAGGG
TCAGTGTAAAATAAATCTACTTTTGGACAACTGAGTTCTCAAACAATTTAACTTTTAGAG
ACCATTTCTCAGGAAGGTACCAGAAAATGTGATCCATTAAAGTCAGAAAGAAAACAAAGC
AAGACTCAAATAAGAGATCTGGGGAAATGGGAGAATCAGTACAGGAAGGAGTTGTTGGGA
TTATAGTGAGGGGAGATTGTTTGATGAGAGCTGTACATCTGAGAGGGAAAAGAAATATTC
AAATAGAAGTGGATGTGATTCCAAGAAAGAAGGTATGACTGTCATTGTGATGATGGATTC
CAAAACATTTGAAATTTCCATCCGAAAGACTTTTTCTCATGTTGGCCAGTTTTTCTTTGG
ATGTCTGAAAAAGAGAGAGAGAAAGTAAGAGGAGGAAGTATTGAAAGACTATCTGAGTAT
GTTAGGAGAAAATTTAAACTATTGGTCATTAGTTATTTAGTATTATGATTTATATCTAGA
TGGAACATCTACATATAACATGTTCTCAGTGGGGAAGCTTTCGGCAGAGATTGAATCATG
GAGGCAATGTGGCTGTAAGAGGTAGGGTCTGGTCAGAAAAGGAGAGCCATTGGTGTGGCT
TGGAAGGGTATATCTTTTTTCCTTCTCCTCCATTCGTTTTCTGATTCCTGACCACAGTGA
TGTGAGAAGATTTTCTGTACCCAGGCACTTCCACCATACTATGTCTGTGTTTAAGTTTGC
TGAACATGAAGTAAAACTTCTGAACTGTTAGCCAAAATAAATCTCTTCTCTGAGTTGTGG
GTGTGGTTATATTTTGTCCCAGTAATAAGAAAGTGACTAAGATTCTGGGACCAGAGAAGA
GGGATTATTGCTGTTACTGACCATGTCATTTAGAATTCTTTGGAAGTGGTTAGGAGAGGA
TTTGGGAAAGGTTTGGAGACTCCAGCAAAGAAAACCCTAGAAGTTTGATGTGTGACACTG
GTTGAATGTCAGTGGTCAGCCTCAAGAGGTTTCAGCTGAGGACTCCAGAGCATGTTCGTT
CATGTTCTGGAAGAAAATTTGTCCACATTTTTCTCATATCCTGAGACGTTGCAGGAGTCC
GAGAGGAAGCGCAGACTAATGAGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAAAAGTTTTGTATTTCACAGTTGAAGCCTATAAAATTTT
GGGCAAACACATACTCTTTGCTGAAAAGATTAGCATTAAATAGAAGCCGAGTATAGTAAG
CTCCCAACTTATGAACACTGAGTTGTGAACTTCCACAGATACAAATGGGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved