Cavia_porcellus Locus Mono:521:SNORA62
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:521:SNORA62
Cavia_porcellus
Mono:521:SNORA62
scaffold_269030
SNORA62
1001..1153
2153
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGTAGTCACATCAAATAAAGCTAAATAAAAGGTTCTTCTTGCTCCCTGCTTCA
GAATAAAAGTTTAATACATTGAATGAGTCCTCTGTATCCTTCTTTGGACAGTATGCTAAC
TAACCTAGTAAAGGTTACTTTTTGAAAAGCTATTAACAGACACAAACATGTCCCAGTTTT
TGGATAACTATTTCTAAAGAAATACCAGTAAATTAATCTGAAGAGGTAAATTCATCAATT
TTTCCTCCAAAGAAAACTTGTTATGCAACATCCTCCCTTCACCAAGGCTTTCATTTGCAA
ACTCACTTTGAGGGTTTAGGTACTGTTTGCTTTCCTTTCAGAACAAGAGCAGAGACCACA
GGGCTTTTTGCTTAAACTTGTTACACCTTTGAGATGTGCATGCTCATTCCTTTGCCCTAG
CTTCACCCGCCAGCCACATTCTTCTCCCACTGGGTCATGAGGGCTTAACTGTGTGCTGTG
ACACAGGCTGTGAGCCTCGCAGGATGAAAGTACTTTTGTGGGTTTGTAGCAGATGTTTAG
CATCAATCTGCACTCCATGATATTGGTGGACTAGAGATCCCATCATGAAAGTGAAAGGAT
TTCAGTCAATAAAACAAAGATAAAGACACAGCAGCACAAGAAAGATGGAAGGAAAAGGAG
GGAGGGGAGAAGGGAGTGACCAAACAAACAAACAAACAAATGAGGGACACTGTTAAGAGC
TTGGAGCCAAAGCCACTTACTGGCCAAAGATCTCACCAGTATAGTGTGCTTCACAAAAGG
CCAGTTTAAGCCTCTAACACCCCAAGGGTCTTTGGGCCAATGACAAGAATGTGATATTAA
TCCTTGCTACAGGGAAAAGGTTAATACATAATAGCTTTGAGGGAGATGAAGACATTTATA
AAATAGCCTGTGTTTTCTTCTACCTTTCTCCTTATTTTTTCATCTACTTAGCCTCTCTGA
CACTACCTGGACTTTCTGCTTTAAAACCAACCTGATGAATCCTGACTAAAATTTTAAAAA
GGTGGCAAGTATGTTGTTCAAACTGATGGGTTTGTCACTAGTCTCAAAACGCTAGTTATA
CTTCGGCATTTTCCACAGAGATTTGGGTTTTGTTTTATTTTTTTAATGCCAGTGTCCAGT
CATTGCTCCCAGAAATCACATTTAGTTGCACTGGGTGGAGTCCTGACAATCGTGGATTTT
TTTTTAATCTTCATGAGTCCAATGTGCAATTCATGTTGAGAACTCCTGATTAACAATGTT
CCTTGTTGAAGCACTTAAAAATGTGTGATTTCCCCCATCCTCTTGTTGGAATCCTCCCCA
GAGCCCCCCACACTTTTTTTTTTAATCATGACATCTCTTGGTCAAGATATTACTAAAGAT
ACTACTACAGTGCACTCAGGTCTGCATTTATGCCTTTGCCTCTTTATTCTAATTCTGTAT
TCCTCCAGAGTATATCCCACACCTGCCACATTTGTGCATCTATATTTATGGTTTGTTTAT
TATCTGTCTTCCCCAGAAGACTAGAAGCTTCATGAGAACTAAAAGATAGATTTTAGCCCC
AAAGGTAAATTAACAAAATTTTCCCTGATGTTTAAATCCCACTCTTCTTTATTTTTTTCA
TTAAGAACCTTACCTCCTGTACAGAGCTCTAACACAAGTATAGAGAACTGGAGAAATGAA
AACAAAGTCCCTGCCTATCTAGTCTTGAGTGTGTGTGTGTGTGTGAGTGTGGCACACAGT
GTGCACGTGTGTGAAAAAGGCATGTAAACAAATATGGTACATGCAAACAATGAACCTCCA
TTCCCCAAACCTGGCTGGAAATTTACGACTAGGAAGTGCTCCAGGATTATCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved