Cavia_porcellus Locus Mono:659:SNORA33
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:659:SNORA33
Cavia_porcellus
Mono:659:SNORA33
GeneScaffold_2297
SNORA33
1001..1133
2133
AGAATTTTAAGATTTAGACCCACACTGGGGCTGGAGGTTTAGCTCAGCGGCATAAGCGC
CTGCCTTGGAAGCAAGCAGTCGTGAGTTCGATCCCCGGTACCGATAAAAAGGAAAAAGAC
AAAAAAAAAAAAAAAAGATTTAGACCCACCCTTGGTATCACATATGAACATATGATTACC
TACACAGATTGTACTAAATAAGCAGAGATTTTGAGACTGTGTATGTGACTCTAACACCAA
TACAAAGGTAATTTCAAAGAATGGAAAGGAACCAGATGTATGGTGGTGCATGGTGGTGCA
TGCCTATCCCAGCCCTCAGGAGACCAAGGCAGGAATAGTTTGAGGCCAGCCTGGACTCGT
AGTCAGAGTAATACTCTGTCTTAAAAAAAAAAAAAAAGCCAGGAAATTTGGGATTTATAT
CTAAATATAATACCTGTAACAGGCTTCCCTCTACCTTCCCTCCTACATTAAGAAAATTAC
CATTCTCTGTGATATTTGATACCTAGGGATCAGTTGACTTCATTTGTGCCATCTGCTCTA
TAGATTCCAAAAGCATCCATCACCCCAGACACCCTCAACCAAGAGATTTTGCATTAAACT
ATATTCCCAATTCCCCTTTTTAACGATTTTGATACAGAATCGATGAGTCCCAAACATTCC
CAGGCTGGAATGAAATTTGCAATCCTCCTGCCTGGGCTTCTCAAATAGTTGAGATAACAA
GTGTTCACTAATACACCTTTTAGTTGTCAAAAACAGTCTATGTTTTAGCAAGCTAACTAT
GCTAGCATCCAAAGGTAGATATTAAAAGCAAAAACAGAATTTAACTAGTTATGTGATATT
ACTAATTAGGAACTGAACTTTTTAAAATCTTATGTGCGCTCGTATTTAATCTTTACCCTA
CTATTCAGCCAGGAGTCAGCACCCAATGCAGTAAGTCAGGGAATAAGTAAGCAAAATGTA
TTTCCAAATTCTAAAAGTGTCAATATTCAAACTACAGATGGAAGCCAGCTATTGAATTTG
ACTATCTGTATGTGATTCTACAGAAATTTAGAAAAAGCTGGTAATAGTAATGCTGCCACA
TTATGAGCCTTAAAAACATTGAAGTCATTAAGGTGCCTAAAAATGGTTACAAATTTTAAT
GATGGAAAGCATTTTTGTAACTTTAAAACTTTACTATATCTAGTGCTAGTGCTGAGAGCT
AGTGAAACTTTTAAATATCAATAAAAACTTGTATGTAATTTTCAAAGGACTATGACAAAG
AATCTCAGGCCAAGGATGTCATGTAAGAAACGAATGAGTAAAAATTTTGGTTCACTGTCC
CAAAAAAACTAGAAGGAATATTTATACAAGGTTTAAGTGCAAGAATATTTTTTAAACTTC
TTCAGAAAATCCAAGTAAGTGTGGAGTGAGGGTATTCTTTTTTTTTCTTTCTTCTTTTTA
GTTTAATCTTGTGGGGTTTTTTGGTTTTGTTTTGTTCTTTGTTTTTTGGGTTTTTTAAAA
CTTGGTTTTGGCTAAGAATAATACAAATAATTTTATTTAGTAGATAACAATATTAATCAC
CTTAAAATCTTGAATTAGAGCTAAACTTGATAATTACCAATACATCTTTTTAAAAATGAG
ACATAAAAATAAAAGTAATTCAATAAATATTTTTAAAAATTACTTGAATCTTGGAAATTT
ACATAATAAACATGGAAATCAGAAATAATTTCTAAATTGAAATGTAGGAATTAAGAGAAT
TAGGCAGCATTGGTTTCTGGCCCTGTCTAGAAGGTAAGATCCAATTAAGATATCAAGTTG
AAAGTTAGGATTTCTGTTGTATTTTAGATCAATTCAAAGTCATGGAAAGTGTTCTTGAAC
TACTGGGAGGAGGTTGTTTTTGTTTTTTGAGATGGGGTCTTTCTGCATAGTTGAAGCTGG
CCTTGGACCCACTATATAACCCAGGCTGGCCTGGAATGGAGTCAACCCTCTTGCTTCAGC
CTCCCTGAGTGTTGGAATTACAGGCGTGTGCCACCATGCCTGGATGGTCTATTGGTATCT
AAAGATGCAATTGTTGAAGTCCTATGATTTGTTTGGATTATCTCTTATTTAACAAATATT
TATTGGCTCCATGAAATAAATGATAATCATATAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved