Cavia_porcellus Locus Mono:255:SNORA29
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:255:SNORA29
Cavia_porcellus
Mono:255:SNORA29
scaffold_255580
SNORA29
1001..1139
2139
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTTAGTGGAAACTAAAAACAAGGAAAACAGGAGGGAAGAAAGAAAGGA
AGGAAGGAAAAAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAGGAAAGAAAATATGAGGGA
AGGGAAAAATGAAATGATTAAATGCTAATTTATGCCTGGATAACAATTTCTGATGGTCTT
AGAAAAGTCCCCTGAAAGTCTCAGAAAAAAAAGAAGAAAGAAAAAACATTTTCAAAACCA
TCATGTATCATCTAACTATGTGGCAGAAATACCGGTAGTTTTTATACCTTTCTTATATAT
GGGCATATGTATGACACTTATACCTAAATAGGTTGTTTATATACAAATTCATATATCTGC
ACATACATGTAATTACAACTCAATGAATTCAATCCCCATACCCTCATTTTAACATTCCTG
CTTTAATATATTAATCTCAGAGAAATTAAATGATTTTTCCCTAACACAGAGCAAAATGAC
GAAGAAACACAACAACTATGAGAAATAAAAACACATAGATACTCTATAAGCTTGTTATAG
TCTGCAAAAATAATTAACTGAATTGCACATTAGTTCTAGATGATTTGGGGGTAGGGAACA
ACCATCAGTAATACACTAGATTTATTCATTGTTCCTATTACCACCTAAAGATTCCCTTTA
GTGTGTTCCTATATAAGATTCTTACATAAGTTTAGTATCAGGTTCCCATTTGACTACCAC
ATTTTCTCCTGTGATAGATTTTAGTGGCTATGCTTATGGGAGAGATGAAAGTTGCCATGA
TCTGAAGAGGGAGGACTTTTCAGTGCCCTCCTCCTATATGGAATGGCTGAACAGAAGAAA
AAAAAAAGTTTAGTATCAGGAATTGGGGCTAAAAGACTCTTTTATGACAATATTGAGCAA
AAGACAAAGAGCATTGGTTTATCAAAAGACATTTGTTCGAAATAATAATATCTACACATA
TTTTTATAGATAAAAAATTTTAAGTGGGTATATTCACCAAATATCCAGTAGGTGCAAGGC
TAGAAACTTTTCAGTACTTTTCTCTGCTTTTATTTCTCTCTGTATACCCACTTTACAGTT
CCAATATATACAGTGGTACCTCATTTCATGAATACTTTCATTTGTAAACAATTTTGTTCA
CAACAGAAATGTTTGGCAAAATTTTGTTTTTGCTGGCAAACTGCATCAGTTGACAATCAC
AACTGCCACAATCTTCCTCACACATACACAAAAGTGGCCATCTTTTCCAAAATTATAGAA
CAAGTTAAGTTCATGAACCAAGGTACCACTGTTTAAAGTTACCTTAATTTTGTTACAGAA
AAACACAGGGTGGTAAATCGTCTGGAAAACCTGCTTTCCAACACGTTCATCATGCACAAC
TTGATGTTAGAAGGCTCAGCCTGCATAAAGAGTAAAGTTGAGAAAACAAAAACTTCTTCC
TTTCGACCCACTGCCACCAACCCCACTCTGTGAGTACTGGTACCACCGACACCAGAGCTC
CAGAACACTGGAGTACCTTCACACCACCAGCTCACAAGTCATCACGCTCTGACGGAGTTT
GAGGTGTTGTCAGCTACCATAATTCACTGCAAACCTTAGGCACTCAGAAGAACTACTTCA
TGAACACTGTAGTTCTAGAGAATAAAATTATTTCATATATGCGATATGCGTTGGACCTTA
AAATAACATGTGATTAAAACCTACAGGGTACTGTATGGCAAGGTTCCCATCCATACTAGC
CATGAAAAGAAACAAGGTGGTTCTTAAAAACAAACACACATTTGGGGCTGGAGGCATCCT
CGGTGGTAGAGCATTTGCCTACCATCTGCGGGCTCCTGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved