Cavia_porcellus Locus Mono:111:SNORD81
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:111:SNORD81
Cavia_porcellus
Mono:111:SNORD81
scaffold_54193
SNORD81
1001..1077
1633
ATGGTCTTTCAGCAATGGATTATCTGTTTAGTAGCTGAGTTTTAGATGTTTCAAGATGG
CCAAGCTGAGGGGGAAAAATGAACATACACGTTTAGAAATTAGGAGATTGGTGAAGAATG
AACATACAATATTTGTTAATTTAATTGTCCTTTAATGTTTGTCTGTTACATAAATTGTAT
TCTGAAATGGGACTAATAATATTATATGCTATGCAGACTTTGATCTATTCAAGAACTAAC
AAAATGTTTCCCTCTATTTCTCGCTTAGGCAAATAGCACAAGCCTTCTACAAGCTGGACC
AAACTAATACTTTCAAAAAAGTCAGTTGTTGTACTCAAGATTTTCCAAAAAAAGAATTTA
ATACAGGACACATAACTTATAGAATTATTTTATAATAGTCACCCAAAGAGTCAAACACAA
GAAAGTACAGGAAATCTCTCCACACACTAAAGACCCAAGGAATGCAGCCAAGGGCCTGGA
TCCCATGGTAATATCCTGATAGTCCAGCTTAGAGCCCATGATAATGCCCCTCACTAGTCC
AACTAGAGGCCTAGAACCCTTGACAATGACTCATGCCAGTCTATTTCACAGGTCTCTGCT
GGGAAGGCTCAAAGATCAGCGGTGGAAGCTACAAAGTCTGTGCTAGCCAAATGAAGGATC
AGTGCCAGTAGGCTGAGGAATCTGCACTGGAGCCAGAAAGCAACCCTCAAAGTAAGAACC
AGAGCTCCTCTGAAAAATACCACAGCCATCCTCAGTGACGATGAGGTCCTGAACTCCTCT
GCTGATGGGAACAGGGGAGTTCATATCAAGAAAAAAGCTTGACAAGCTCCTCCAGGATAA
CCAAAAGCAACAGGAGAACCAACAAAACAACACTACTTCTTCCTCTACAGTCCTTCTGTG
CTGTTGGCAACAATCCTCAGGTGGGCCATCCATACTCAGCATCAAGCTGATTCATTTTGG
CTGGGTGTTACAAATTACCAGTTGTCAAGCCACCATATCAGTGGAATACATGATGATCTC
ACCTCAGCTTGAACCCTCTCCCTGTTTACTGGATGATGAGCAAAGATCTAATGTTCTAGT
GTTCCCCAAGAATTGTATGAGTTGACATCTGGCAATAGGGTTAAAAGAAACATCTTTATT
GCAGGAAGCTAGATGAATACTCATTGAAGATTTAACCTTGTCAATTTTTAATAAATTTCT
GCAGTCAAAACAAAACAGGAATAATATAAAAAACAAAAAACAAAAAACAAAAAACAAAAA
CAACCCAGTGGAGTTCTTGCTTGGGCTTGTACGGGAAGTGATCACACCTTTTTAGTAACA
CGACAGAGAAGCCGTTTGGTTTAGGAATGCTTGGCTTTCGCTGCTTTTAAAGAAAAGGTG
AAAGAAAGTTTTTAAAGCAGTTACTCTACTCTCATTTCTTCTGGTTGGGTTCCTGGTCAG
CCCGTCGGTCTCATGGTTAAGTTTTGACGAACGGTGGAAGGCTGCAAAGCTTCCTTCCTT
TGGAAAGTCGATGAATTTTGCACCTGACAGTTTCAAGATTCTGTTGGACAAATAAAGGAA
AATTTATCAGCAACATTAATAAATTTTAGTTTCAGGAAGGAAAATTTGGTTTCAAAGAAC
TGAGGATAGCAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved