Cavia_porcellus Locus Mono:439:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:439:SNORA70
Cavia_porcellus
Mono:439:SNORA70
scaffold_215937
SNORA70
1001..1135
1442
AATCCTTGTGTCTGGGGGAGTGATTTATTTTTATGAGCATTGATGTACATTGATGCAAT
TGATGAAAGGCAAATCTTACAGTAGAAAGTTATTTGACTTGTTTTCTCAGATTCTCCCCT
TCGTAGTAATGAATAACAGTTGTCTACGTAGTTACTGGGTGGGAACTGCCCTCAATAAAG
CATGTGACTTTCACAGTGATGGTTGTCTTCACCCACAGATAATTTCTTTAGAGGACGATA
GCTGGCACCCACAACCTTCCTTCCATAAAAAAGAGACAAAAGATGAGCCTCAAAAAGACC
TGACCCAGCTGCAATCAATGAAGCTAACTCTATTACCTTGCTGGTGGGTGCTCAGCATGT
AGTGTTTGCCAATAGCAACTTCCTCAGGCGTGTATGCAGCCTGTTGCTTGTACAGGCTGC
CTTAAAGGGTCTTGGAGATGCTGTTTCCTAGTGGGTTGTTGTATACCTGACCTCCCACCA
TTCCAAATCTAGTCTCCATACAGGCATACAAGATGCTTTCATCAAGCCCTAAGACCCAGC
AACAAGGGTTCATACTGGGACATATTGGACAGGTCTTTCTATACACTGTTGGTACAGCCC
AAATACAAAGAATATGTGATAGATGCTCTATGCAGAGCCAATTTAAAGTTCTCTGGCCAC
CAGAAGATCCACATTTCCAAGAAGGGGTGCCTCACCAAGTTCAATCCATGTATTTGAAGA
TATGTTGGCTGAGAAGCACCTCAGCCTTGATGATTCCTGTAAGGGTGAAATATAGCCTAA
CTTGGAGTCTCCTGGACAAGTGACAGGACTTGCATTCCTGAAACTTTCCAGGGTGCTGTG
TGCTGCCTCATCTCTCACTTAAAAAGTTCATCTACAAATCTTATCTCCATCCTCCCTGAA
AAGAAAGATCTGAGCAAGCACTACAATGATGACACTTTCAAATTCACTTAATCTGGAATA
AGCAAAATCAAGAATAGACAATGCTGAATGAAAAGGACAATACTGAAGACATCATTATAC
CAGAATTCAAGGTATTCTAGTAAGACAGTAGCAATAGCAACATGGTACTGGCACAAAATC
AGAAATGTAGACCAATATAATAAAAGACTGAAAAACAAATTCAATCACCTACAGCCAATG
GACTCTTGACAAAAGGGATGAAAACATATCTTGTGTCTTTAACAAATGGTGCTGGGAAAG
CTGGATATTCACATGCAGAAAAGTGAAACTAGACTTCTGTACTCAGATAAAATAAAATTC
GACCAAAGTCCTAGATATAAAGTCAGAAACATGGACACTCTCAGGAAACAATTTACAGAA
AACACTTGCAGTTCAATCAATGACTTCCTGCACAGGACTCCAGATGCACAGGTAATAATA
TTAAGAATGGACAAATGGAAATACATGAAGTTTTAAAACTTTTGCACATCAAAGAAAGCA
ATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved