Cavia_porcellus Locus Poly:20:SNORA73
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:20:SNORA73
Cavia_porcellus
Poly:20:SNORA73
GeneScaffold_6579
SNORA73, SNORA73
1001..1204, 2147..2350
3350
TGAAGTTTTTTAGGCAATTCATCTCGAAGCACTCTAGTCCTATTTGTCAAATTTCTTTC
GCATATGATAGGGAAAATATCCTCTTTAAGGCGTCTTGCTTTTCTACAGATGTCTTCTCT
TATGTTGCAAACTTTCCCAAATATTTTAGCCAATTAATCTAAGAAGAGAGTTCACAGATG
GAGGTAAACCACAAAAAACACTTGATCCGCTCCATTACTGTCGCGTACTCAGGCTCTAGT
ATCGCGAGACAGCTCTACTCAAGGTAGGGGTGGGGCTTAACTGCATACGTCCCAGCGTCC
TTAGCAAACTTCCAATTCCTTAACTGCGCATGTCATACACGTACGCCCCCTTCGTGAGCT
ATAAATATGGCTGCTCTGGCGGTTTTTCTGTCTTTCGGCTGCGGGAACGGCGCCAGCGGT
TTCGCTTGTTTTGTTTTGGTGAGCAGTTTTACCATCCTTGTTGCTATATGTAGGCCTCGG
TTCTGCAGGCAGTCTATCCTGAAAATATTAGTGAGAAGAAATACCTTCAGCTGCCTGCGT
ACCAATGAGGCAGGGAGGGCTGGAGTGGTTACGAAGACCCGGGGTCTGCGTACGAAGTGC
GCCACTACACATTCTCGGGGCTGCTAAGTACGGCGTGGCCTCCGCTTCCCGTGGTGGTTC
TGTAGTCAGTCCTACTTCCTAGCAGGCGCGTGTTCGATGCGCGTTTGATACTGGGCCTCC
ATCCGCGATAAAATTAAATTAAGGCTTTATAGATCGTAAAGAATTAGGGGCCAGCCATAC
TTGCTCTGAGTTTTGCATGGGTTAGCACATACTGTATCTCTGCTTTTGCCATTACTATCC
GCTCAGTGCCTGTTAAGTTTCGAATACTGTTGATAACTCGATGATCTTGAAGTTGAGTTT
TGGTTGCATTTTGGGGTTTGACCACAGTATATCCAGAAAAATCGCTGTACATCAGGTAAA
AATTGCTCAGAGTGCCTTTGTTACATGAGTTTCTGACTGTCCCAACGTGGATACCCCGGG
AGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGGCTCTGCCCCGTG
ATGTACAGTCCCTTTCCACGACGTTGGAGAAGAAGCCGGGCCTTGTGTCTGCGCCTGCAT
ATTCCTACAACTTCTCAGAGTCCTTTGGACAGTGACTGAGGAGATAAACCATGCAGGAAA
CAGTCTTAGATTTGTATGTAAATTAGTCTCATTGAAAAAAATCTGTTTTAATGTCTTGCT
TGGTGAATCATTTTCCTTACAGAATTCTTTGAAGATTCCAGATAACTTTTTAGTCAGGTA
AGTAAATCAGCACAATTGTTTTTGATTAACTGTCAACTGATAATTAGTCGAGCTCTACTT
TTTTTTTTTTTGAGCTCTACTTTTGAGGCATTTAATCATTATAAACGCAAAATACTGCTA
TTCATTTACTAACTTGATACTGTGTATAATTTGAGTATATTTGTTTCTTAAAAAAAAAAA
AACCGTGGTTAAAGCCGGATATGGTGACACAAGCCTGTTGTGATCCAGTGCTTGAGAGGC
AAAGGCAAGATGATTTGAGGCCAGCATGAGTTACATAGTAAGTTAAAGGTCAGCCTGAAT
TACAGTGTAATTCAGGGACCGCACAGCAAGACTCTTGTCTCAAAGACAAAGATTTGTTTG
ATCAAACTGTTATTATGAGACACAGAATTTTTAATCTGTTAAGAGTCAAATGTGTGACTT
TGTGGTAGGGTAGTACAAGGTCGAGAAATGAAGTTGAGAGTGAGTTTTATTGCAAATAAG
AGCGTACTTTCTGGCTTTCCAGAAAGGGTCTTAAATTGGGTAACTTCAGAGACCCTTTGT
TATTTACGTAGCAAAGTCATACTGCCATTGACCTATAGGGTTATGAGTAAAACTGCTTAG
CTAATACTAATGTAATAGAGAAATGAGTCAAGTAGCAAAGGTGTATGGAAAGAATAAAGG
CTGTGCTTTTTTCTTTTTTTAAAAAACAAGCTCTTGCCATGTCGTCCAGACTGTTTATTA
TGGTAGAGTCCTATTCCTATGCATCTAGGTAATAACTTAAGTAGGGATTCAAGAAAAGCC
TGTGAAATTGTTTGGATTTGTCTTGCTCTGCATTGAAGGCAGGAAATCCAACGTGGATAC
CCCGGGAGGTCACTCTCCCCGGCCTCTGTCCAGGTGGCATAGGGGAGCATAGGGCTCTGC
CCCGTGATGTACAGTCCCTTCCCATGACGTTGGAGAAGAAGCTGGGCCTTGTGTCTGCGC
CTGCATATTCCTACAACTTCTCAGAGTCCTTTGGGCAGTGACTGAGGAGATAAACCATGC
AGGAAACAATGTTTAGTCAGGTTAAGCCTTCAAACTTGAGTTTACAACTGTCTAGGGTTT
ACCTCAGCGGCAGGCACAAGCACCTGCCAGGCAGGTGACGTGAGCTCAATCCCCAGTATC
AAAAAAAATAAATTTGAGGGGCTGGGCATTTAGCTCAGCAGCATAAGCACCTGCCTTGCA
AGCAGGTGGTTCGTGAGTTCGATCTCCAGTACCGATAAAAATGAAAAAGACCAAAAAAAT
GGAAAAAAAAATAAATTTGAATTACAAACTTCAAAAATATAATCTTGTGTTCCTTTTCTT
TCAGGAAGAGTAACCATACTGGACTTACATCTAATGACCTGGTTTTATTTGGGTTCCTTG
AATTAGGGAAACCTGGTAAAGTGATGGTGGTTATCTTTGGGGATTTTTCCAGTAATACTG
TTTACCTGCATTTGTGTTATTTGTCTGGTTTGTTTTTAGGTGGGGAATCACTATAGTTTT
TATTTTTTCTTTTTTGAGAGAGGGTCTTGCCTATGTAGTTCAGGCCTGCCTTGAACTCCT
TTGTATCCCAGGCTGGTCTTGAATTTTTAACAATCCTACCTTAGCCTCCTGCGTATTGGG
GTTGCAGGATAAGATACCACACATGGGTTGTTTTCGGTTTTTTTAAGATGGAATCCCTAT
GTAGTTTAGGCTGTCCTTGAACTGTGCTCTCCTGCCTCAGCTTTCCAGATGCTTTTTAAA
TGGACATAATTAAGTGGGGAGAAAATGTTCAAATGAAAGGAAACACAGGAGAGAATAGAG
ATTTTAAAAATTAAGTAGATTGTTTTTGATTTTTGTTGTTTATTTGGGGGAGGTTTTTTT
TCTCACTGACACCAGGCCTGAGCTAAATCCCCAGCCCCAGTTTGGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved