Cavia_porcellus Locus Mono:361:SNORA70
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:361:SNORA70
Cavia_porcellus
Mono:361:SNORA70
scaffold_66647
SNORA70
1001..1131
1329
ATACCCCCAGCCCTCTTAATTTATTTAGATCAAGGTCTCACTAAATTACCTAGGCTGGG
CTGAACTTGTAATCCTCCTGCTTCAGCATTCTTAGTAGTTGGGATAACAGCCACCATGCC
TGGCACTACGGGTGAGTGAAGAGTGGGCAGTGGTGCATTGTCCCCTAGTCACCCTAATCC
TGTGGATATGTCTACCTCTATGTAACCAGTTAAACCAACTGGCTCTTTCCTTGTGGGCGG
TGGGATGCAATGGCTGTAGGTAGCAGCCCCCTTGGCAGTTCATGCAGCTGTTGCTTGGAT
GGATTAAATTAAGGGACTTTGGAGACAGATGCCCACGTGCTGTTCTATTCTAGGCTTAGA
CAGCTATTTGATGTGGCTTTGGAAAGCCCAGGGCACAGTGACAGGCATTCACACTGACCA
AGTCATCATAGCTATCCAGGTCATGTCCATCCACAAAGCTGCAGGACAGGAGCCCACACA
AGGCCGAGATCAAGTTCTCTGCTGCTAGAAGTCCACATTTCAAAGAAGTGGGATTTTACC
ATGCATGTTTAATGCATGTGAATTTGAAGACATGAGAAACAGCCTTTTTGGGTGGCTGTG
GGGTTAAATGCATTCTCGGTCATAGTCCTTTGGACAAACAGCAAGACTTCCATTCATGAA
GGCTTCCCATCATGCCCACCTGGAAATCCTACTTCCTTTTTTTTTTCTACCTTAAAAAAA
AAAAAATACTGCCAGAAGGCAGATAACAGAAGTTACAGCTAGGATGCACTCCATACTACA
GCAGAGCTTGGATGCCCCAAGTTCCTAAAAACAATTTGAGATTTGGGTCCTTATTTAAGG
ATAGAGGACACAATATTTATCTCTAATCGGGTCTGGTCAGAGCCCTGTCCCTCTGTCCTG
GGGGCCTGACCTGAGGTGAGATCAGATTGTGCTGCAGATCTGTCCATGTCCTGCCCCAGG
CTTCCTGCCTGGCTAGTCACCTGATTCCAGGAGAGGCTGCGTGTGCCACGGTAAACTCTG
TCCCCATACAGGGATAGCTTGCCAGTGGGGAGTCCTGTGCCATCTATTCCAGAAGCTGCT
GCTCCACAATAGGTGGTAGGAACCAGAAAAGGCCCTGATGTGTCACCAGCTATGCTCAAA
GCCGAACCCTTGCCTGATAGAGTAAGATGTCCTGTGGCCACCATCCCCTCCAGGTCTTAG
CATCAGCAGATTAACTGTCAAGCAAAACTCCTCACTATAGCTGGGTACCACAATTTACCC
ATGTTATTGACCAGCAGGTCAACCTGGAGACCTCACCCATTTTAGAGGCTTCCAGAGCCC
AAAGGATGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved