Cavia_porcellus Locus Poly:19:SNORD58
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:19:SNORD58
Cavia_porcellus
Poly:19:SNORD58
scaffold_250274
SNORD58, SNORD58, SNORD58
1001..1066, 1387..1452, 3096..3160
4160
TGGTCTCCAATAGCACAGCAAAAAATATGTAAGTAAATACTTTTTTTTAAATTAAAAAT
TTTTAAATAAAAATGTTCAGAAACAATAAAAAGTGTTATGGTTCTGTTTTGTAATACGTG
ACCTAGAATTACAACCTGTTCTTAACTGATATCTAAAACCTTTAACTATTTTTGGCTATG
AAAAAAGAATTTTGAGACAGTGCCTAGGAGGAATTTAGGTGGTGGACCACTTTAAAACAT
ATTCTACACTCCCTTGATTTCGCCCTCCTCCCTTCCTTTAGATCGCGTTTCTTCAATTTG
AAATCTCGCGAGAAGTCGAGTTCTCATGAACTCTCGCAGGAACCACAATTCTTCCTCTTC
CTGTAAGCGGCCCAAGGTGAGTGTTGTAGTGGTTTGTTGGTCCGTGTGTTTAATCCTCCC
TTCATCTTCGCCATCCTGGCCTTACCGGCTGTGGTGTCAAGTCCTCCGAGAGGGAAACTC
TAAGAGCTTCGATTCATCCCTGAAAGAGGTGTTCCCTTGTGCGGAGGGAGGTGTCGGAGC
GCCAGATTTACGACAGAGGGCTCAGCCGGCTTCTGCAGCTTATGGAGGAATGGAACGAAC
GGGAATGGGGGAGACTGGGCTCTTCCGTTGGTGTGGGCATGGGTTGCCTGGGTCCGTCTC
GCTTCCGAAGGTCCAGTGTCCCACGGTGAGCAGTGAACAGGTGGTGTTGAGGCTTTACTC
ATTTCGTTAGTGCTGCACGCTGGATGGCTCTGGGCGTGGGTGAAGGCCGGGACTGGAAAG
CCTGCGTTACTGTGATGGCTGCGTGAGTGAGGGAGGCTTCTATACAGAGAGGGAAACTGA
TCTTGGCTTTTACCATGCTCACGCGTCACGTTACACTTGAAAGAGCTGGGGCTGGCTTGA
AGGGCTCCAAAGGGAAGGGAGAGCGTGATGAGGGTGACTGGTGATCAGTGCTGTCTTTAC
TGGAAGATCCAGAGCGGGGGAAAGCACTAGGGCAAGGATGGCTGCGGTGATGGCGTTTCT
TAGGACACCTTTGGATTAATAATGAAAATAATTACTGTCTGAGCAGCCCTTACCATCAGT
ACTTTAACTGCATTAGTTCCTGAAGTATGTGTTATTGACGGGCTAGTGCTGTCTTGCAGG
TAACCTGTGAAAATGGTTCGCTACTCTCTTGACCCAGAAAACCCCACAAAATGTGAGTAG
AACTTAAACTCGGTTTTTCTATTTTGGGGTGAACATAGAACCCAAAATTAACAAAGACTT
TTTTGTTTTTTAGCATGCAAATCCAGAGGCTCAAATCTTCGGGTTCACTTTAAGGTATGG
GAATTCGGACTAAGATCTAAAGAAGTTTTACATGTACTACTAGTAGCTTTTGGTTTAAAA
ATGGTAGCTGCGGTGATGCCTTTCTTAGGACACCTTTGGATTTACCATGAAAATAAATAA
AATTCTGAGCAGCTACCTTTTATGTATTTTAAGTACTTTAAGTACACAGTACTTAGAATT
TGAGGAAATAAAACTACTTGATAATGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCCTTTATTTCTTGATGTCTTGGTTCTCAGCAGTAATCTCATGCGAATTTAT
CTAAAATTTTTTTATGATAAGTCTGACTTTTTACTGTAGGTGCTTGTGAAGTGTTTTCCT
AGGCTGAGGGTTGGTTGTAGAACATTTGGCCCTACAACTCAGGGACAAAAATATGTTTTA
CCAAATGCTGTAACTTTTTCCATGCTGTGGATCTTTTTGGTAATACAGTTGTCAAAGTGA
CTGCCCTTTTAGTGGTTAATGTGGTTTGTTGCCTACATTTGTAAGGAAGAAAAATAGTAA
ATTTCAGATTAAAAAGTAAACAGGATAGTTGACAAAAGGTTCTCCATTGTTATCTTTCAC
CCTTTTGCATATAAGTCTAGTACTGAGCTAGAATTATGTTAGAAAGGCTTAGAAATTGGC
TTTGCTTTATCCTACACCTCAAGCCCTTTAATGACCTGTAGGGTCATTCATTTAAAAACC
TACAAAACCTTGCATGGTGGCACACAGCTGGAATTATTGAGGTAGGATTATGAATTCAAA
GCCAGCTTGCAACAGAGACCCTGTCTCAGAAACAACCTATGTTTAAACCCTAGTGCAGTG
GTATGCACCTGTAATCTTTAGTACTTGAGAGGCTAAACCAGGCAGATTGCAAATTTAGGC
CAGCTTGGGCAATTAGGCAAGACTAGCTCAAAATTAAAAGGGCCAGGGATGCAGCTTAGT
GCTAGAACATTTGCCAAGCATGTATAAGGTCCTGAGTTCAATCCTCAGTGCTGTAATGGG
GATAGGCGGGGAACACTTGGTTAGTCTGTTTTTGAGACAGGATCTGTTTTAAGACAGTCT
GTCCTTAAACCAACTGTTACGGAATAGAACTGAAGGAAGTCCTCAACCACCTTACAAGTC
CTGAGATTACAGGTGTGTTCCACTACACTGTTTATGGTTTTTTTGTTTGTTTTTGTTTGG
TTTTGGGGAAGTTTTTTTGTTTTGTTTTTTGGTGCTGGGAATCAAACTCATGACATCATA
CTTGCCAGACAGGCATTTGTGCCACTGAGCTAAACCAGCCCTACCATGCCCAGTTAAAAA
AAAAAAAAAACACATTTATTTAGTGCATTGAATTCAATGATGATTTAGGTGCTAATTTCA
TTAAGGCAAGGGTTTGAGGCATGATGGGGAATTTGTCAGTGATATGGTTTGGTGTTAGAA
GTTACTGCCTGAGTTTTATCTTTTTTCCTAGGGTTTAGATGTAGATTCTCTGGTCATTGA
ACATATCCAGGTGAACAAAGCACCCAAGATGCGCCGCCGTACTTACAGAGCTCATGGCCG
TATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACTGAAAAGGAACA
GATTGTGCCTAAACCAGAGGAGGAAGTTGCACAGAAGAAAAAAGTAAGCAACTTGGCACC
TCGGTTTTGTTGGTACATAATACTAGAAATATTTGGTTGCTGTGATAACTATCTTAGGAC
ACCTTTGGAATCACCATGAAAGGAAAACTATTCTGAGCAACCCTTTACCCTTTTTTTTTT
TTTTAAGTTTGGTGACCCTGATTGGTTTCTTTACTAGTAATATATAATAACTGCATTTGA
TAATAATTAGCTGTGTCATTTTGTCAAAGTGCTCATTATTAGCAAATGATCGTGTTCAGT
TCTTGAAGCCAAGGAATTGCCTGGGAATGATTCTATAGTTTTCCCTTCACAATCGCCTTC
CATTAACGTTCTCACTTAAATGTTATCTGCTCCTTGCTCTTCTTGGGCCTTTGGTCCCCA
GCAAGAGTTGAAACCCAGGATTTATTGTAGGTTTGTCCTTAATGGTCCTTTTTTTTTCTT
TCAGATATCTCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAATAAATTATGCA
TTAAATAAATTCAAATAAAAGTAATATTGTTTGCCATTATTAGTAAACATGTTATCTGTC
CTTACAAGATGGATCAAGTGGGTTTAATTAATTGACTCAAACATGCTAGTTGTAGGGTTT
TTACATTTTGAAATGAGATAGTTCCTAGCCAGTGGAGCAAACCTTTTAGAGCTTTCAATG
ATAACAAATTCACAGCAGCATCTATGCCATAGTAGGTTCAATGTTTCTCATAGGTGCCAC
TTTCTAAACTGGACTCTAGCCCATTTGCTTCAGCCTCCCAAAAGTGCAATTAGGTAATGG
AATTCTTGAAACTGATTCTGATCTAATATCCTTAGCAAGATTTAGAACACAGTTCACTCA
CTAAAAATGCAGCAGGATTGGGTATGATGGCATGTGTCTGTACTACTACCACTGAGAAGG
CTGATGCAGGAGGACCAAGTCTTGGGTTTGAGGCCAGCTTGGACTACATAGTAAAACCCT
GTATCAAAGACAACCAGAAACATTTCAAAGCTTAATATATTTATACATCCTGCCACCATA
ATCCATTGCAGAATGTTTTCCCTGACCATAAAGGAAGTTGTGGAGTAGTGAAAAGTGTTG
AACATCACTGCCACCTATAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved