Cavia_porcellus Locus Mono:167:SNORA2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:167:SNORA2
Cavia_porcellus
Mono:167:SNORA2
scaffold_70201
SNORA2
1001..1138
1384
TTTTGTTGCATGTCTACTATGTGCCAAATACTATACCAGTTACATTATTTCATACAAGC
CTCACAATAAGTCTGAATACATTTTAACACAAATTAAGAGTCAGAGAGAGGTTAAATAAT
CTAGCCCAATTTCATTGAGCTAGTGCAGAACTGAGATGCAAAACCCAGCCTACATGATTC
AAATCAAGTTATCTCCAAAGTTCATTTTCAGGACTAAAATTCTGAGACTAAACAAAAAGC
TAAATTGGTGTCTCTCAATCAAGACCTGCAAATTTGTTGTAGCTGCTTGTTTCAAACAGG
AATTCAAAGAGAAGTCTTTCTAGGATCTGTTGGTGATTTCAGAATTTTGGAAATGCAACA
GTCAGTTCATTAGAAAGAAATAGCTTCGAGCCTAATACAGGCCTGAACAGAACCCATACT
CTGAGGCTTGGCCACGAGAGGCCCGGCAACCTGGTGACCCCAAAACTTAGTCAATTGTGT
ATTGAAGGTTTGATGAAAAAACAAACAAACAACAAAAAACAAAAACCTAAAGACTTGGTT
CTGAAGGACTTCTATGAAGATAAAAAGGACATGTGCCCATGCTGGGAGGATGGTACACCC
CAGTTCCAAAAGGAGAGAAGCTCCAGTGCTGGTGACCTTTCCAGACCTTAATGGGAAAAT
AAATGAAAGCTGAGGTTACGTGGAGCACTCTCTCCTGATGGGAGAAAGTGAACTACCCAG
CACCTGCAGCACATGTATGTATACAATCAGCATATGATTAAATTCATGGAGAGTTTAAGG
GGAGGATGAGATGTAGAACAGGAAGAATGGGCTCAGAGAAGAAACCGTGCCCCAACGTTC
TGTCAGCAAAAGGGGAGCATGGGAGAGCCACACCTCACCTCTCCACCACTACAGAAACCC
CAAATAGGAGGAATCCAGGTGCCTAGCACAATCCCCTACACTAGGGAACTGGCAGCCAAT
GCAGGAAACACCTGGGATGCAGTCATGGGCTGACTCAGACAAACACAGGAAAATGTCAAC
ACAAATGAACAAAACACAATCTTAGACCTCCAGCCACCACTGAACAAATTCAGGAGACAC
AGACATAATAGAAATTAGGGGTTACACACCTGAAGTTTCAACTTAGTTTTTGTATTCTTT
GGTCAATTTTACATACCTATGACTGATGGCGAACTATTTTTAAGATAACAAGATGTATTA
TGGTAGCCAGTGTTAATTTCCTATTGTCTTGTTTTGAACTCCTTTATCATTTTTCATTGT
TTTGTTTGGCTTTATTCTGTTTTTCTTTTGTGTAGTTGTAACGTGTCCAATGATCTGGAC
AGCTATTTTGAAGATGAGCAGATATATTATAGTAGCGACTGTTTGATTTCCTACTATCTT
TCCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved