Cavia_porcellus Locus Mono:SNORD26
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORD26
Cavia_porcellus
Mono:SNORD26
scaffold_44
SNORD26
1001..1072
2072
CCCCAGTTCCCTTGTCTACAGAGTTGATGACCCCACTCTTTCTCGAGGCAGGATCCGCG
ACGGAGTTCAGCCGGGCCTGGGAGGAGGACGCACCAACCGCGGTCCCCGGGGCCCGGCCC
TACCTGAGTCGCCACCCGCGCTGTGAACCTGCGCGTCGGGCTCCGAGAGCGCGCTCGGAG
GCGGCCGCGGGCCCTGGGCATCGGTCGGGAGCTCGAGCTCCGCGGGGTCCATGGCAGCGG
GGCTCCTCGCTGACTCAGCCTAGAAAGGGCGCAGAAGCCGGGGCTAGACTGCAGTCCCCG
CACCCGCCCCACCAGGAGAAAACAAAGGACGCATGCGCGCCTCTACCAGCCGCAAGCTTT
GGGCAGGGAGCATGCGCGCCTTCTCCCGCCTCACGTTTATGGGTGGTATGTTTGAAAGCC
TGCCCGGAAATTTTCTACCTGTAATTCTCACCGCTTAATTTTTTGAATGCGCATGCGCAT
GATGTAGTCCCGCCTAAAAGTCCCGTGGGCCTCCGCGGGGTGCTATTTAAGTGGCTCTCC
GCCGTACACGAGGTCTCATTTTATTGTAGCTGCTGGTGAGTATGTGTGGTAGGTGGCTTT
TTGGGTGCTTTAATTAATTAAATGAACTTAAGAGCGTAACGCTCTCTGGACCTCCTCCCT
GTGGTACACTCTCCAGGGAGTGTCACTGGAGAGGTCTAATCCGGGTCTAACTTGGAACGG
CGAGACGTGAAGAACAAAATGGCCGGCGCAGTGGTGGGTGGTGTGCGGGTGGCCGTCCCT
GTGATGAGGACTTCACAGACCTGTGCTGACCTCCAATGAGGACGACTCTCTCTGAGGAAA
CGGCCAGTGGCCCATTCAGCCATTGCGCGGGAAATGCATAGTGCTAATCTCGAGACTTTT
ATCTGCAGGGTTGGGGCCGCGTTTGATCTCTGGAGCCAGAGACCGCTGTCTCCGGGTAAG
CAATGTGACTCTCCCTGACTTTCCAAGGCCTCTGGGATGTGCTGCAGGGATGAGTGAGAA
CTGAACTCTCTCTTTCTGATGGCTAAATGGAGAAAGCAAAAGTTCTGAGTAGCATCGTCT
GCAGGGTTCTGGGCCTTCTCTTCAGGCTGAGGCTTTAGTAAAGGGTGCTCTTTTTCTCAG
TTGCATTTCAGTTCAAAAGAGCTTGGAAAATGAAACAAGATCCATCCTTTTGCACAAGGA
GTGAGCTAACTCGTGGAGCAGTGCTTCAGGTGGGTGCATGGTTTATGTAATGAGGGAGCT
TTGAAGGCCACTCGATGATGAATAGAAATGACAAGCATATGGCTGAGTCCTGAGTGATGT
CATTTTAATGCTGAGAAGTGAGCAGTTTTCAGAGTCGAATTTTAGCTCAGTGGCATAAAC
GCCTGCCTGGCAAGCACGTGGTCGAGAGTTCCAATAACCATTACCCAAAAAAAAGGTGAT
CTATTCTGAAGTATGAGCAATGCCTTCTTCTGTCTCTAGCGTTTCAAATCCGGTCCTGAG
GAATTCCATTACTACCCAGGATGAATACAGGTAATTTTTCAAGTGAGGGCTTGGGTTATT
TTATGTCTTGAATATAAACACAGTCCCGAGAGTGAATAATCAGAAGAGCATTGGCCATTT
TGCTCTTTCCACCTTGTTCTTGAAGTGATCATTGGGAGAAAACAGTCCCATAGTACAGTT
GCTTCTTGTGATGGTGTGCTCTTCCCTCAATACTGTCAGATGATTTGAATCTATGACCTG
ATGCACTGTGAAGTGGCGTTACAGCATGTTAGAGTTCTGATGGCAGTTTTGGTAATGAAT
ACATGGGTCTTTTTGTCCCTAACACTTAAAAGTAATCTTTCATTTTCTCTTTCCCAGGTT
GTCCTGATAATTTTTTTCCATCCAAAGGTAAGTGGTTTATCTTGTTTTTTTGTTCTAAGT
TACATGAACCCATTATCCATAGTACAGCAAATCGCTGATGGAGGCACAGCTTTGTTGATT
TCTCCTGTTCCTTGTGACCTTTGTTGCTCTCCCCTTACTAGATGCCAGCTGGTCTGAAGA
CTCAACTCTTGAAAAGAGTTGAAAGTGCTAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved