Cavia_porcellus Locus Mono:SNORA26
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORA26
Cavia_porcellus
Mono:SNORA26
scaffold_84
SNORA26
1001..1119
2119
TAATATGCATGAGGCTCTACGTTCAATTCTTAGTCCCCCTTGAAAAAAAGTATAACTGG
CCTTCACAGACAAAATAACCTTCTATATACAAAATAAGCTAAAGGATGAAAAAAGCCAAT
TAGTCAGTTTTGCAAGGTAAGTGTTTTAATAAGTTGATGTATAAAGCATTAAAAATAATA
ACATTTAGGAAAAACTTGAGCTTTAATTTCTTTCAACATGTAATGCAGTTAGAAGTATGC
ATAGGTTTTGCAGTGCTGTGTGAATTGTTGTGTATTATGTATATATATGTAATAACCTCA
GTTATCATACTCAATTTGTACCAAATTTGTTTGAGTGTAATAAAAACTGAGAACTGCACA
TATTTTTCCCATAAGAAATAATTCAAAACCAAATAGTTGATTCTGAGGCCCAAAAATTAC
ACTTGTATATCATTTTCCCAAGATTTCAACAACTTGCATGATGATTTCTTTCTTTAACTC
AGTTTTCTCCCTTACTGCTGATATCACTGACTTTTTTTAGAGACATGTTAATGATAATTT
ACACACAAAAAGAAAAAAACAACAGGATGCTGAATATTCTAATGCAGTAACACAAGCACT
ATCTGTTTCCTGAGCGAAAGCATTGCCGCTTTGTGCCCTGGGCAAGATGCAGCCCTTGAC
TTGCTCTCAACCTGAATGCAATAAAATTACCAATACTAAATTGTTTTTTTCCAACTTTGT
TGTCTGAGGATGGAAAGTTTGAACTTGCAGTTGTTAAACTGAGATGTCAACTTTGTTGTA
TTCTTAAATGTAGTTATTCTATATCACAGCTGTTCAGCCTAGTTTTTCTATAGATTCTGA
TAAAGGTGTTTTAAATGCTCTATAATTACGTCTAGATTTATTTTTTTCCTTTCACATTTT
CAAATACTTAATATAAATCTCATTTATAAGTGTACCTCAGTGAAATGTATTTCAGTTCTT
TGTGCCACAGTCTTTTAGAGTAGTGTTTATTGCCCTTTGCTTTGCCCTTTTAAGGTTGAC
ACAGTGCCTTCAAAGGGTAATACAGAAGGGAAAAGAAAGACTCCTTAAAGCCCAGATAAG
AGATTAAACTCTTCTTTGGGTCCTGTCTGGAGTCACAGGTGGGAAAAAAAAAGTGGTATC
GTTAACAGTAGATACTCCTCCATTTTTACCTTGTTTTTTTAATTCTTAAACTTACGTTAT
TTCTCTTATAAGTAAACACAGAAATGTCTTGCATTTTTAGAATTAAAAAATACTTTTTAC
TAGAGCATTTCATTGCATTTATATGTACAGTGTCTGCTAAACAATGCATACACACTCCAA
GAAAAGAAAAATTGTAGGGGGAACCTTAGAGAGTGTCATATAGTGCAGCAAACCCACTAC
ACTGCCAACTTTTAGACAAGAAATTGAAAATGCATGCGCAGCATCTAGTGACCAAGGTTA
CCCATGCAGCAGTTCGCTTTAGTAATGAGTGTCTGGAAGCTAATGGCCACCACTTTAAGC
ACTTCTTATACTTTCAGAAGCCAAAGGTGACTTCTATTAATGTCATGCTGTCACAGTAAA
TTTAGTATTAAAATGTTTATACAGGTGTTTTTTCCTGAAGTGTGTGTACGTTTTTTGATG
GACATTGTAATGTAGTTTCTGATAAAAAATACAGTTTGTTTATGGTAATTTCTTATGTAG
CCTATATTTTCTCTCTCCTCTGTCTCCCTTCCTGCTTTGTTCTTAATTTGATTTGCTTTC
AAAATAGTCATTTTAATATGGACTAGTCACATATCATAGACTAACTGCTGAAAACTTAGT
TTTTTTCCTGATCTTTGTGCTGATTTGCTGTATATTTATATATTTTATTTTGAAATGTAT
CCTGGACCCAAAAAGATATTACTGATGTAGTTTCTTTAGAAAGTCAGTATTTTTAATAAC
TCAGTATTCTTTTTTGTTCTTGTAGTTAACCCTTCAAACTATTTTTCTTTCAGCCCACAG
TACTGCAGTGTTTTATGTAGTGTGGATTATTGAAACAGAGGTCAGTCAGCTTATTTTTTC
TTGACTGAAAACACACTTTCCTTAAGTTTTGAAGAACATTCTTTAATCACATTAGAAGTA
TTTCTAGTTTGTTCCATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved