Cavia_porcellus Locus Mono:217:SNORA42
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:217:SNORA42
Cavia_porcellus
Mono:217:SNORA42
scaffold_241683
SNORA42
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTCTCTCCACTCATGGAAAGCCACACACCCCAATCTGTTTCACATACCGGGCGCCTGAAT
CTACTCTGAGCTCAGGCGAGGAAGAAGGTGTTGCTTCCTGGGATCCCTGATCCCCAGCAG
CTGGGCACAGATGATGCTGTGGGCGGGAACTGGCTGTGCACTAGATGCATAAACCGATGT
GAGTGCACTGTTGTTTTCTAGATAAGAGAGCAAAGTGAACTTTTCCCCCTATAAGGTTTC
ACTATGTAGTTTAGGCTGTGCTCCCAGCAATCCAGGCTCAGCTTCCCAAGTGCTGGGATT
ACAGGTGAGAGCCACCATGCTTGGTGAACTATCTTTTAATGTCAAAAGCAGAACAGCCTG
GGAAAAACCGTACAATATTCTACCTCTCAACGACAGTCTCAAGCACAGGTTCACCCTTCC
ACACACAGAGTGGAGAGGCCCCCTTCACACTCCACGCGTTCTTATGTTGTTTCGGGAAAT
TTCCCAAGTCAAGCCAAGCCAAAAGGAAGACTCTTTGCACCAAGCAGAGAAGGCAGCATG
TCATCTTTACCCCAGTGGGCTGTTGGGAGTTCACGCCAGTGGACTGTGGCAGGGATAATT
CCTCCCCAGGAACCAACCTGAGTCAGGAAGGAGTTTGGTCTGTATAGAATTAGAAGGGGG
AGGTACAAAGCAAGTGATCAGGGTTATGTGATTGGTACATACTTTGGACCATAGATTGAC
AGACAGGCTGGGCTTGAAGCAGTAGAAACACTCCAGGAACCAGGGGTGGAGGTTCTTACT
CTACTTAAGGGCATTACCATAATACAGGAATTGTTCTGGAGAGAGAGCCTTGACTGAATG
AGAGTGATTAAAGATGTTACCATAATATAGGAATGTTCTGAGCATGGTAATGGATTTATG
GTGGGTCCAGCTGTGTGGGCCTTTCATAGTGTTTCCATGCAAGAGAAAGCCTGGCTCCAA
CCATTGCCCAGCCCCTGCTGTGGGCTGTGAGCACTGAAGCAGGCCGCACAGCTTANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTCGATCTCACTACCGCCTGCTTACAAGGCAGGTGCTTAT
GCCACTGAGCTAAATCCCCAGCCCCTTTTTTTTTGAGACAGTGTCTTGGTGTGTAGTTCA
GGGCGACATCAAACTTACAGCAATCCTCCCGCATGAGCCGCCTAAGTCCTGGGACTCCAG
GTATCCCTATATCCTCTTTATAATTACATATATATCTGTGTAAGTGCTTACAAAGAATTC
CAGAAGGTGCTACCTCAAGCCTTCAAAAGTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved