Cavia_porcellus Locus Poly:23:SNORND104
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:23:SNORND104
Cavia_porcellus
Poly:23:SNORND104
GeneScaffold_3436
SNORND104, SNORA76
1001..1070, 1275..1405
2405
AGCGGCTCAGCGCCTGCCTGGCAAGTATTTGATTTCTGATAACAAAAAAAATTCAAAGA
AGGAAAAAACAAACAAACAAAAAAACAACAACCTGGGGGCTGGAGATTTAGCTCAGCAGC
ATAAACGCCTGCCTTGCAAGCAGGCAGTCGTGAGTTCGATCCCCGGTACCGATAAAAAGG
AAAAAGACAAAAAAAAAAAAAAAAACAACCACGACCCCCCCCCCCCCACACACATACAAA
GGTTTACCACAAGTGACAGTAACTTTGCTATGCTTCATAATTTGAGGCGGGGTGAGGATA
GGTCGGTTTATTTCCTTTTCTTTTTCTTTTTTTTTTTTTTTGAGATAGGGTCTCGCTAGG
TAATCTGGGATGGCCTCAAATTTATACTGATCTTCCTGCCTCAGTTTTCCTGAGTGCTAG
GATTATGGGCGTGCGCCACCACGCTCGGCTATCAGTCTACTTTGTAATAGTTTAAACTCG
CTCATTACTGGTTACTTTGAACCTAGGGCGGTTTTGTTTACATTCTGAAATCCTAGTCTA
GCAGGTGGCAGAGTATGTCATAAAAATTAGGCTTTGTCTCCCATTTTCCAAAGTTTTCTT
TTGTGTAACGTAGATAGATGCGCTAATTACAAGATTAATGATTAAATCGTACGAAGAAAT
TAGGAAGAATTGAGAAGTCCGGCTACTCTTAATAAGGCTCTTCCGGCCTTTCCTAGTCCC
ATCTCTATGGTTGAAGTGCGACCGCTCTATACTTTTGGAGGCTTTAGCGAGCACGGCCAA
TCATTAGGTCAGTATTGCAGCCTATTAGTTGGGAGTTTTCGCTTACTATTGGATAATAGC
AGTAAGGCCGGCGCCACTACTTCGTGTATAACTCTTTAAATGGAATCCCGCGTTGGGACC
ACTGCCTTTTGGCGACGGCGGACACTGGAAGGTGAGGCGTGCTGTGTTGCTGAGTGGGAA
GGCTGGCCTGCCCCGGGAGTGGGCTGGGAGGCAGTTGGCTGGCCGTGATGACATTCCAAT
TAAAGCACGTGTTAGACTGCTGACAAGGGTGATGCGAACTGGAGTCTGAGCCGGTTGTCG
GGTTCACTGAGGGGAGGAGACGGGCCGGGAGGCCCACACTCGCTGACATACAGTATGCTT
TCGTTTTTTGCAGATCCAGCCATGCCAAGGACGTCCCTTCTCCTTGTCTAAAGCGTGTTT
CGAGCTGTTTCTCCCCACTCCAAATCCCTCAATAAAGTGATTCGGCCCCAGCTTGTCGTC
TGTGTGGTTGCTGACGCGCTGCCTTTGAGCCCCCGTGCGCCTGTGTGTGGCGCCGGGGGT
CAAGCTGCGGCGCCAGAGAAGGTGCTCGCGCATAACTGGGGCCGCCTGCCGTTCGCCGAC
GGCCCTTTTAACCGCGAGCTACACGGCCGCCACCCGGCTGCTGGGGAAACCAGCACTTTT
ACCGGGCTAAATGCATACAGCGGTGCCTAGTGAGTGCCCCGCCTCTGCGCCCGTACGCTG
TACCTCCCCAGGTTGTCTGCCAAGTCTGCAGCTGCCGTGCTGGCGGAATACAGGAGATGT
ACGTGTTACGCGCGATATGGGATGGGCAGGTCAGACAGCAGCGGGATTAGACGAGAACTG
GCTTGGGGCTGGAGCTGGGTATGGGTTTAAGTTCTGGTCAAGGCGTAGTTAGGCATACAA
GTAAACTTCTCAGGTAACCGTGACCACCATGGACTTTGAGATGAGCTGTCCAGTTAGCTT
AACTGCATAGTTACAGGACGGCTGTGAAGTGACGTTTGAGGGACAACTTTTACAGTTGGC
TTTACGCGAATGTTCACCTATGTTGAGGGTTAAGGGTGCACAAGTGAAGAATATTTGACG
CGTGGATATTAAATAAATGCCCCAGATTAAAATTATGACTGGAAATAAGAGTATGGGTTT
CAGCTCTGGAGCACAATTACCCGGGTTGCAATTAGGTTAAGGTTATCTGAACTTGGTTAT
TTAGATGTAGACTGAAATGGCACCTGCCTTACGTTAATGCCATTCTTAACCATAGGCGTA
GGTGGCACTGTGACACTATGGATCAAACCAAGAATCACTGCTAAATCTCAACAATTTAGT
AAGCTAAAGCTTTAGAGAAGGGTGAGTCAACCTAATGACAAAGTCCCCTCTTTGCCAAAA
GCAACATGTCAACCTATGTTCTTGTTAGCGTTATGCTCTAACCTTTATAAAAGGTGGCAT
GTTACTGTCATTTTTTAAAAATCTTGTGTTTTTGAGGTGAGATCTCGCTATGTAGGCCTT
GTACTGGGCTATCCTACCTCCCTGAGTGCTGGGATTAAAGGCCCACACCATTGTACCTGG
CATCTGTTCTGTTCTCACTTTAACACTTCTGTTAAATACTCAATTGCAGAGTGGCCAAGT
ACCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved