Cavia_porcellus Locus Mono:709:SNORA44
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:709:SNORA44
Cavia_porcellus
Mono:709:SNORA44
GeneScaffold_6988
SNORA44
1001..1129
2129
CGCTTTGCAGAGCTGGGGGAGGCGGATGTTCGCGAACCCACACGCGCTGCCCTCTGAAA
TACCTATTTACTTTCAACAAAAGAATAAACACAAGCAAAGCCGAGGCCGGTTCGCTCCGG
GGAGCCTCACCTTCTATGGCGCGCGTCTCGGTTCACGTGCTCCTGCCGTCCGCGGGCGGG
CGCGCGGCTGGCGGGAGAATTCCCGGCGCGGGTAGTCCCGGGATCAGGTGGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTTTGGGATCAGTGGGT
CCCATCAGAAGAACCCTGTATTTATGAGATTAATGCATGCATAGCGTAATTTTATGAATT
TAAATTTATTTTAAATAGAATCTTGAGCTGCATGTAAGAGCAACCTAGAGAGACTCTGAC
AGCTCAGGTAGGCCCAATACCTGAGGCTGCCACTCACCTTTCCTATAAGGAAAAAAAAAA
AATGGAATTTCTGTGTATAAGAAGTGTATGTAATGTATACTATATATACATTTAAGTTTA
TTTACAACAGTATGTTGGTGATACAGACAGTGTGTATAACACACAATATACATATAATTA
ACAAGTGACTAGCTTGCATGGCCTTTAAATATCACAGCACCACAGGACCATCGCTATGAC
TATGAATTGGAGTATTGAAGTATACTACCAATGTCAGAGAAATATTCTAAACACCAGGTT
TAATTTTAGAACTGAAAGGGGAAATTTGTTGTTTGTTAGTTTCTAAAAGCAAAAATAGCA
CATCAAAAGTAGCAGAAGAGGAACTGTAAACTTTCACAGGGATGGTATGAGGATATTTGG
TTATTAAACTTACAAGAAAACTTTATTACCTTCCATTACAGTGTTTTCTGTAGGTAACAA
TGGGAGGTTACTTTTCTGTACTTAGTCCAGTATTCAGTATTTCAGGCTCCAAAAAGTCAT
ATCCAAAGGAACAGACAAAAATAGATAAGTAAAGTAATTTATACAGTTACTCCACCCTCA
AGAATGGGGCATAATCCTCACTCTTTAGGTGTATGCTACACACAGCCACTTCCTTCCAAA
GAGCACCGTATGAGAGGGGGCAAAGAGGCTTTATAGTAGAGAAAGCTGACAAGTGCAAGG
GATTAATGGGGATAAGGCATGAGCAGTTTATGTTTAGTCGATGTATTAAGGATGTCACTT
TAAGCTGGGCTTGGTGGTGCATACCTGTAATCCCAGCACTCAGGAGCAGGCTGAGGCAAG
AGGACTGCTGCAAGTTCAAGACCAGCCTACGCTACAAAGTGAGCTCAGGACCAGCCTGAC
CTGCATAGCCAGACCCTGTCTCAAAAAGACAAAAAAAAAAAAAAAGTCACTTATTTTTGT
GGTACTCCTCTCAAACACCCACAGCTTTCATCTGGTAATGAGAAAACCATCAGCCAAATT
CCAATCCAGAAGCCTTCTACAAACTGCTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved